[NOT POLITICAL] The Twitter Voicemail Story - Megathread
1275 2018-03-17 by Arszilla
Since /u/clicheteenager decided to post on the same topic resulting with 2 posts with different activity levels I decided to combine the two with what we know and what we get. Thus a megathread. I'll be keeping this up to date as much as I can.
STORY (MAJORITY ARE IN CHRONOLOGICAL ORDER):
On 13th of March 2018 @ 9:57 AM Twitter user Ty posted this:
https://twitter.com/strayedaway/status/973604056005570560
EDIT
Since he deactivated the account, watch the voicemail here
Now if you write down the first letters of the words (NATO Phonetic Alphabet) you get:
S Danger SOS it is dire for you to evacuate be caution they are not human 042933964230 SOS Danger SOS
The message seems to be on a continuous loop. Plugging those numbers on Google Maps and you get a few places. One in Africa and one in Malaysia. Pointed out on this tweet by Uzumaki. Uzumaki also believes this is related to the solar flares that happened recently as this tweet points it out.
Ty also claimed that he had people taking pictures of him 3 AM; using a flash.
https://twitter.com/strayedaway/status/972026675298033664
Next, Ty says he received messages in DMs. Here. Now the message is in Indonesian. If translated you get:
end the post you just shared about the recording in your phone.
Ty gets more messages as seen on this tweet. One of the tweets is a string of numbers, one has Morse etc.
20.8.5.25 1.18.5 20.1.11.9.14.7 15.22.5.18 41818
Twitter user ItsmeSHanelPuff decodes some of the messages in this tweet. One of the messages the user decoded says
They are taking over
in this tweet.
Twitter user ariff_balang enters 20.1.11.9.14.7 as a website link and gets this as a result. He also analyzes the last message and says this:
That last one is in perfect Malay. The recorded (voicemail) on twitter above is used for classified information which should not be shared to public.
If no action is taken,the issue will be re- analayzed and any type of penalty will be acted upon. Status 85-5612
Twitter user TribalRider investigates one of the accounts (Hijj370 AKA April 2x3+6+6) that messaged Ty on this tweet of hers. Then she records this in case the account gets taken down/deleted. Its a video that seems to be reversed. The reversed audio was posted on this tweet; mentions MH370 quite often; sounding like Flight Control tower?
Twitter user scottgrant917 decodes one of the Morse saying this on this tweet:
One of the morse codes gives you "ETTETEEEETTEE" I searched that and it lead me to a Fuel Cell Installation and Removal Guide for Aircraft.
http://republicseabee.com/Files/Fuel%20Cell%20Installation.PDF (The file in question)
Another morse code was decoded, has Hawking's Death mentioned, and the morse message was sent on the day prior/on the day Hawking's died
I forgot to give source of this so take this info with a grain of salt or ignore it completely. Since Ty deleted/changed the name/deactivated his account I cannot confirm this info.
Twitter user Hijj370 (April 2x3+6+6) AKA Cicada370 (Username as of right nowUSERNAME CHANGED/ACCOUNT DELETED AS OF 17-MAR-18 GMT 1400) sent this QR code which reads out
UPDATE
https://twitter.com/hijj370 is back. Log everything.
6+6+6 iriga, bjvw tzm llgxtivvb kmtckcs
Twitter user A_Monica03 tweets this saying with this image:
If you type 6+6+6 iriga, bjvw tzm llgxtivvb kmtckcs on google it will show u this, idk maybe thr people who built the plane used this material
Also, Twitter user drwsdrizzyy says:
6+6+6=18 iriga is a city in the Philippines bjvw tzm llgxtivvb kmtckcs???
Twitter user laurengardner88 tweets this with this image saying:
just leaving this here 🤭 pic.twitter.com/4GYUgNc9vI
The news holds up on ABC's article
Meantime 4chan created a thread at /x/ which got 404'd later on when Hijj370 changed its account name. Original thread vs the archived.
/u/lmgbylmg joins this thread, saying he knows Ty and shares some of his conversations. Last one he posts (https://imgur.com/a/b8t6X) has Latin with an image of a priest (?) "exorcising" a "demon"
The Latin text reads:
Omnes mos mori
Which means "All will die"
Depellendam malum
which means "Dispel the bad"
~~Right now Cicada370 (AKA Hijj370 previously) is very active, posting tweets every few minutes; mostly QR codes, ASCII85 encrypted texts and such
https://twitter.com/Cicada370~~
UPDATE
Ty AKA https://twitter.com/strayedaway has deleted/changed the name/deactivated his Twitter account as of 17-Mar-18 @ GMT 1600. Guess the stress/messages got to him after all. /u/lmgbylmg knows him IRL, so do keep us up to date about him /u/lmgbylmg
CICADA370
https://twitter.com/Cicada370 - USERNAME CHANGED/ACCOUNT DELETED AS OF 17-MAR-18 GMT 1400
First tweet ever posted says:
null lclcr puisr fmzio ydbvk uqcpi fycyw qsipx ziwtk az
And according to Twitter user LAexpress12 it is DNA strands on this tweet posted by him. Now there has been sightings/captures of abnormal creatures near the coordinates given at the start of this post. These two videos display them:
https://www.youtube.com/watch?v=3bWBB7PdNXc&ab_channel=gants99
https://www.youtube.com/watch?v=AfzpQARXZh0&ab_channel=THEELECTSHALLHEAR%3ABrotherKhaamah
Second tweet by Cicada says:
ꟼlɘɒƨɘ ƚɿy ƚo unbɘɿƨƚɒnb, you ɒɿɘ wɿonǫ ɒdouƚ ƚʜɘm , ƚʜɘy ɒɿɘ noƚ oƚʜɘɿ dɘinǫƨ, ƚʜɘy ɒɿɘ noƚ uƨ duƚ ƚʜɘy'ɿɘ uƨ
which reads out as
Please try to understand, you are wrong about them, they ate not other "beings", they are not us but they're us
pointed out by Twitter user LopezMybuttlf on this tweet
Third tweet has Morse:
-.-- --- ..- / .- .-. . / .-. . .- -.. -.-- / ....- .-.-. ....- .-.-. ..--- .-.-. .---- ----- -....- ..--- / .. ... / - .... . / -.. .- - .
Which says
YOU ARE READY. April 18 IS THE DATE
which was pointed out by Twitter user xochtille on this tweet.
Fourth tweet is the reversed video mentioned before. Was reversed by Twitter user drwsdrizzyy on this tweet.
Fifth tweet is another Morse
._-.-....--..
If you paste this to Google you get some handwritten then photocopied notes:
Sixth tweet is a QR code. Its the same QR mentioned in the first part of the post. Twitter user A_Monica03 says [this]https://i.imgur.com/fGvGPBm.png) on their tweet with this image:
If you type 6+6+6 iriga, bjvw tzm llgxtivvb kmtckcs on google it will show u this, idk maybe thr people who built the plane used this material
Seventh tweet is a coded message that results with this according to Twitter user scottgrant37 on this tweet:
You may not find 370 but you can find what caused it go 370. And you don't have to find who caused it, they will thus find you
Eighth tweet is ASCII85 which says this according to Twitter user meepmeepee on this tweet.
Please don't mistake them as other beings thet are you but related unrelated
Nineth tweet is another Morse code that reads out
You are gonna choose yourself, you are gonna find the cosmos being
according to Twitter user IPomegranate on this tweet.
Tenth tweet is another ASCII85 claiming "Hence this is a final goodbye."
It reads out
the reason im sending the earth beings this message is because i am disguising myself from your ancests
when decoded with Enigma.
Eleventh tweet is an image. Looks like a monitor (There is a cursor) and a plane in sight. Looks like thermal cameras?
Twelfth tweet is a QR code with a set of numbers on top of the tweet.
Numbers read:
44.244167, 7.769444
and when plugged in Google Maps it leads to two different locations; one in Europe; in Italy, nearby a place named Colletto Fava as depicted in this image here.
The QR code links to an imgur upload, with a plane in picture.
Thirteenth tweet has a "blank text" that results with Microsoft saying "Translate from Korean". When analyzed deeper it is a coordinate but unsure where it is as users are not sure where it leads to.
As I was writing rest of the 26-29 tweets the account vanished again. Last thing I have is the latest profile picture which was a QR code:
https://pbs.twimg.com/profile_images/975001205398261760/TNPeiZuj.jpg
POST 2ND SHUTDOWN (AFTER CICADA370)
He has changed his name to Hijj370 once again and has this in his profile. First thing he tweets after coming back is this. His bio has a Morse code
_.--../.__----...----
When decoded it results with:
add onion
He changed his name to
DIMASRYP REA EMOH
which is an anagram for
PYRAMIDS ARE HOME
A tweet posted prior to the shutdown shows this. When decoded it reads
Cicada was a test You are now ready to face them 9+13+1
as decoded by Twitter user jonathonxspeed on this tweet.
Prior to the shutdown of the account few hours ago he changed its profile picture to this. When decoded it reads
59 6f 75 20 73 65 65 6d 20 74 6f 20 6b 6e 6f 77 20 74 6f 6f 20 6 d 75 63 68 20 61 62 6f 75 74 20 74 68 69 6e 67 73 2e 20 59 6f 75 20 77 69 6c 6c 20 68 61 76 65 20 74 6f 20 65 78 70 6c 61 69 6e 20 77 68 61 74 20 61 6e 64 20 68 6f 77 20 79 6f 75 20 6b 6e 6f 7 7 2e 20 77 68 69 73 6b 79 65 63 68 6f 61 6c 70 68 61 74 61 6e 67 6f 68 6f 74 65 6c 65 63 68 6f 72 6f 6d 65 6f 40 68 6f 74 6d 61 69 6c 2e 63 6f 6d
When translated from Hex
You seem to know too much about things. You will have to explain what and how you know. whiskyechoalphatangohotelechoromeo@hotmail.com
The next tweet after the big QR code is this, quoting the big QR. It has written either "nothing is real" or "real is nothing".
The next tweet is another QR that says "goodbye" and links to this website, a website of last words of planes.
The next tweet is a weird image.
The tweet after that says "We are lunarRabits".
The next tweet is this. Which supposedly reads out
"it is not the end, this is the start.
The tweet after the one mentioned above is a video. Sounds reversed with some sounds in the background.
It says
July 17 2014
Which is the day Flight MH17 was shot down over Ukraine by Ukrainian rebels.
The next tweet is this.
Another video was posted after. It was reversed by Twitter user HipsteerZarina in this tweet. It reads out NATO Phonetic Alphabet and says
LUNAR IS HOME WITH SPACE TRIANGLES ARE BUILT WITH HASTE
The tweet afterwards is this. Which reads out:
Ready for stage
Next tweet in line is this. When decoded it leads to an onion link which results with this.
Next tweet is another QR. When scanned it yields this which looks like a pyramid on moon.
Another QR. This one yields:
<+oue+EqO9C
m1u+EV:.+DbJ-F<G[>D.Oi(+EqO9C
m8"F)Pl<AKYi8+CSbiDfor>$<1\IDJO;9AoD]4CLq'rBl7Q+F8IIBln#2FD,5.G@>N0Bl7R)$<_:i+CT;%+Eq73Eb/c(@:F.tF<G"2EbT=s8TZS&DfdU@AM,_l0fUdpF
]5j0JP780er(@<,q'ASc0*ARTV$BP_C#B6+DRF
(W.6?R0`Bk;>m882gR
which translates to:
This will be the last time i will desolve my account Thanks for keeping up with the warnings You are wanred about april It.not.be.2018.but.1010010 Farewell earthlings LunarBunnies
Last QR posted as of GMT 1900. It says
That evacuation message was transmitted in 1969 It was for humans But not humans too LunarRabbits evacuated to Earth On VIII March future past from today They faced something You may know what they faced something We do not harm We lost homes We live with you We lived with you before
Another tweet, tweeted at GMT 1914.
There is no afterlife We are cosmos dust Hoax is sent until it's a fact goodluck goodbye
POST NAME CHANGE FROM HIJJ370 TO CICADA3311
Latest tweets from @Hijj370 (AKA Cicada3311) (As of GMT 2110) says:
Hijj Ends Cicada Continued
×It will be continued in 16 hours
×Everything that's unrelated to the quizzes will be posted in English
×Nothing is a troll
×past hijj tweets were hints to the upcoming quizzes
Goodluck
You will need to back up previous tweets for future quizzes
×This Event is no where related to catastrophic events
× 18 april is definitely safe
×All other accounts are impersonating
×reason to hold this event is to help people solving a upcoming global cicada event
×reason to hold this event is to aware people with knowledge
Don't get fooled with impersonators
They want attention
No possible way a social site is being used by other beings
Our quizzes can only be solved by different ideas
Means you have to form a group
Goodluck
Cicada3311
Everyone who is claiming to be other being is a fake They have to reported We tweeted similar things to clue up the future quizzes with hints
Our goal is to aware the internet with hidden
Opening our dms for private questions you would like to ask.
Thats not the Cicada way....
Goodluck
Cicada3311
POST CICADA ANNOUNCEMENT
Choose 1 side
https://pbs.twimg.com/media/DYhVsQSWAAUYU-o.jpg:large
Second tweet
No point of us getting fame, 1×we are not advertising something 2× it's a ARG
Bdbxtjmsa1
https://twitter.com/Bdbxtjmsa1
One of the accounts that interacted with Ty.
First tweet. If translated you get this.
Sixth tweet. If translated you get this.
INTERESTING STUFF
https://twitter.com/Cicada370 - The account in question. Was named Hijj370 previously, named April 2x3+6+6 (Signifying April 18 again for some reason). A Redditor pointed out 'Hijj' could be a slang/short term for 'Hijack' thus 'Hijack370', reinforcing the idea that this is related to MH370.
Remember the search & rescue ship that went off the radar for 3 days and the crew wouldn't say anything about their disappearance? They went off the grid for 3 days and appeared out of nowhere near the shore.
https://www.theguardian.com/world/2018/feb/06/mh370-search-ship-disappears-for-three-days
/u/imheckinbamboozled shared this:
OK call me crazy but check out this out:
A twitter user posted https://www.youtube.com/watch?v=e_1haffjVWI on the twitter thread link to a very creepy video posted a year ago. The title is the date that was mentioned on one of the creepy images with a bunch of seemingly random numbers. I have yet to figure out what these numbers mean so if you have any ideas please tell me.
NOW
If we go onto this persons channel we see they have many creepy videos, some more recent than others. Ive watched most of them and I don't see many connections, but in the video "song for jack" a creature can be seen sometimes, maybe relating to the creature talked about in the voicemail.
OK back to the original video. In the comment section youtube user "Domas Šleinys" (https://www.youtube.com/user/doomas9/videos) posted a comment (https://imgur.com/a/SYMR3) saying "cicada 3301" with a link to a very creepy website.
Now looking at Domas's channel we see that he posts many creepy videos, his most recent relating to the cicada 3301 project. His other videos consist of songs and weird videos. This looks like it could be a dead end, but looking at the website he posted we see a video on the main page.
On the main page there is a block of text
Eagle rain fire on the canaanite, as the merchant of wine challenges crys, the sword of lilly joins forces with jacob's adopted children
Now if we inspect element we see https://imgur.com/a/Wh156 .This is related to the 2018 Cicada puzzles.
Now I know what you're thinking, "where am I going with all of this" and I must say I don't really know. Could these voice mails possibly have to do with the Cicada puzzles? Could something major happen on April 18th relating to the Cicada puzzles or the voice mail? I really don't know. I could just be grasping at strings and be completely wrong. This whole voicemail thing could just be an arg. It could also very well be related to the Malaysian airlines flight, but I'm just putting out some information that I found interesting
/u/jojowasem shared this:
Ok, so on one of the County Bluff videos (https://www.youtube.com/watch?v=fn6xh1xekHw) a part of a QR Code flashes in the screen - https://i.imgur.com/4jGt1kw.png I started by trying to reconstruct the square parts and got this - https://i.imgur.com/Wo7FyBm.jpg (I think the glitchy parts will not make difference when reading it, so that's way it's not so pretty) When you try to read it you just got an error, of course.
Then I tryed to copy the part from the "6+6+6 iriga, bjvw tzm llgxtivvb kmtckcs" QR Code and got this - https://i.imgur.com/IlOSyb1.jpg It still don't read the QR, but if anyone just like me is looking throug the ARG perspective and manage to find another thing that looks like a QR just reply or message me.
A redditor sent me this; a video recording from Cicada370's page that was reversed. He/She reversed it again and sent this via PM as he/she doesn't want to get too much involved in this.
/u/MaliciousKatz shared this:
What's up with the rabbits?
Italian coordinates mentioned. http://www.italianways.com/the-pink-rabbit-in-colletto-fava/
u/JordanMckee pointed this out:
Just realising that before Cicada370 deleted their account again, they posted something that said "We are LunarRabits"
well, look at https://imgur.com/a/5RfEJ
see a connection?
/u/Nerfmatrix shared this:
i ran the qr codes Hijj370 posted through a qr reader. bigger qr this one gave me a series of numbers or letters that i ran through google and it led me to chapter twelve of War of the Worlds. ch 12
small qr this qr code led me to this site last words shits spooky my guys
/u/ErichlllZann shared this:
I admittedly skimmed the top post so I may have missed this, but has this video been mentioned in here yet?
I came across it on one of the Twitter threads last night. Comments should explain...
This is from the Twitter thread (before Ty deactivated his account). This was supposedly recorded near the last place MH370 was seen at.
/u/purplemonkeydisheZ shared these which are supposedly from Hijj370/Cicada370
A person/silhouette at 16 second mark
Water heater with a dead body in it NSFW
/u/domthebomb2 shared this:
here is a twitter account we found last night that replied to the original tweet. It seemed to be nothing, but we were able to decode the audio file on the video on the account which gave us this image which contains the text "mischief re" which we think means mischief reef. This island is actually called Woody Island, but there are theories that it could be connected to Diego Garcia. There is still undeciphered code on the account.
A redditor sent me this:
https://redd.it/8523q4 (Posted by /u/skimmer47) (BACKUP IN CASE IT GETS DELETED: https://pastebin.com/K401ZjET)
/u/GangsterWisdom wrote this:
No.
https://twitter.com/MondoCorp/status/974704188327432192 (Last message decoded. Enigma code. Says "the reason im sending the earth beings this message is because i am disguising myself from your ancests"
There are two e's
Thee Reason
That extra e belongs near the end of the message, anagrammed and jumbled.
NET SCARE etnearcs
Center As ET Near CS CERN Seat Traces NE
Center CERN As ET Near
CERN Traces ET As Near Center CS NE
interesting
Posted by /u/eikogray1111
I want to point out a few things. When the flight went missing years ago, I was researching it that week at work. At first, authorities were claiming it was a terrorist and used a young Arabic man as a scapegoat. I cannot remember his name but he was young about 20 or so. They said he was on the plane. I found him on facebook. I kept going back and forth to his profile. I sent him a friend request just to see what would happen. Then my computer started acting weird. I couldn't find him in search, and sometimes I could when I restarted the computer. Then the official narrative changed and they weren't blaming it on him. If someone could help me find the news article mentioning his name.
Second point, on April 16 two days before this is supposed to happen, NASA with the help of SpaceX is launching a rocket from Kennedy Space Center in Florida. NASA has created TESS which is being used SPECIFICALLY FOR seeing a "planet" passing in front of 200,000 of the nearest stars to us. If stars get dim, it means something is passing in front of them. This is being attached to a Falcon launcher made by SpaceX. NASA and different congressmen have said in interviews how important it is that SpaceX gets this rocket launched by the 16th and not earlier as well as it is imperative because SpaceX will be helping to transport astronauts to the space station. I do not know if this specific launch is transporting people. On April 16 it is going to be a new moon, meaning the moon will be at 0% visibility and will only be at 8% visibility on the 18th. It will be completely dark and it will also be easier to see whats going on in space with our eyes. There is also a meteor shower happening in that time. There was a message that was decoded that mentioned watching the sky and the moon.
Third point, last September, SpaceX rocket launch failed. Exploded on the launchpad. Although the official statement after investigation was that it was malfunction, Elon Musk said in an interview that they found the wreckage riddled with holes, like bullet holes. He was very worried the rocket was literally shot by something to sabotage and exploded. They have invested more in security. A spacex employee showed up at a building near the launch asking security to let him on the roof because he saw a shadow then a bright light on their roof before the explosion. They refused. I cannot find the employees name.
Next point, this isn't all entirely surprising to me. In 2017 the CIA released over 12 million documents because a lawsuit was won that they had to make this info public online. Beforehand they had been forced to make it public because of freedom of information, but the CIA put it on one computer in a library in the northen US. So another lawsuit basically said this was unfair because the general public couldn't get to that specific library. In the press conference they didn't get into what was in the documents just that you could read them on the CIA website. A hige chunk of it is evidence they have gathered about extraterrestrials as well as paranormal phenomenon, remote viewing, psychic abilities, the true nature of the universe, experiments. Basically it was full disclosure without them having to put it into very clear terms to the public to avoid panic in my opinion. Go to the documents and read about project Gateway. The document is Gateway with some numbers and letters.
Trump said this week the US is going to invest in creating a "SpaceForce" to fight wars in space.
This may seem unrelated, but its strange. When the solar eclipse happened last year, I did a lot of research on it. If you dont know already, the constellation patterns at that particular time perfectly matched a revelations prophecy. That being said I am not a Christian, but Im not kidding perfect match, look it up. Anyways, I was looking into the trajectory of the eclipse path across the US. I noticed that one edge of the shadow would go exactly through Elberton, GA. Elberton has the Georgia Guidestones which is long story short a monument that was anonymously erected by a group of Americans to basically be the commandments of the new world order. Theres a lot of facts and weird things about it please just go read it. I have been to the Guidestones twice. The first time, I got a very eerie feeling. The second time I went was last September. At the base of one of the stones was a salt circle and in the middle was burnt candles and matches. Someone had purposefully broken the salt circle. Some of the monuments had plaster inside the carvings, I guess where someone had tried to make a copy of the words. Its just odd to me that the eclipse shadow would pass exactly through that area. In a few years another total eclipse is going to happen and it is moving in the opposite direction across the US and will make a perfect X. The day the eclipse happened, I sat outside under it. After it was over, i felt completely wiped of energy and passed out for hours.
All that being said, might seem unrelated, but I have spent a lot of my life connecting dots to things abd have come to realize all of it is connected. People want to believe conspiracies are a joke but time and again even governments have come forward abd admitted to them all the time. The whole point is to make conspiracies seem like a joke so no one will pay attention.
One last thing, Net neutrality repeal is officially going into affect a few days after the 18th, on the 23rd to be exact. It will affect us, if something actually happens, from being able to warn each other on here.
UPDATES
Ty AKA https://twitter.com/strayedaway has deleted/changed the name/deactivated his Twitter account as of 17-Mar-18 @ GMT 1600. Guess the stress/messages got to him after all. /u/lmgbylmg knows him IRL, so do keep us up to date about him /u/lmgbylmg
~~Cicada370 AKA Hijj370 is back. LOG EVERYTHING GONE AGAIN BACK AGAIN!~~
I updated majority of the tweets etc to Imgur images so they dont go dark/get deleted.
Added other Redditors contributions/findings.
UPDATE AS OF GMT 2000
Added all the latest tweets by Hijj370 under POST 2ND SHUTDOWN (AFTER CICADA370)
UPDATE AS OF GMT 2110
Hijj370 renamed itself to Cicada3311.
https://twitter.com/cicada3311
THIS IS NOW A CICADA PUZZLE. NO PGP SIGNATURE THOUGH. TAKE IT WITH A GRAIN OF SALT.
UPDATE AS OF GMT 2210
Cicada3311 opened their DMs for question and said this is an ARG.
UPDATE AS OF GMT 2215
ACCOUNT VANISHED AGAIN. PROBABLY DELETED DUE TO BEING CALLED ON BULLSHIT REGARDING NO PGP
UPDATE AS OF GMT 1200
CICADA3311 IS BACK. STILL NO PGP
UPDATE AS OF GMT 0850
I AM UPDATING THE POST. GIMME SOME TIME. TAKES OVER 2 HOURS TO REFORMAT THIS.
1352 comments
86 Cap_james_hook 2018-03-17
If the world ends before smash 5 comes out I’m gonna be pissed
27 Arszilla 2018-03-17
lmao
priorities
6 amnesiacPterodactyl 2018-03-17
man I’d be more pissed if the world ends just Days before Infinity War comes out
5 chipple2 2018-03-17
Half life 3
2 pwaves13 2018-03-17
By that logic the world will never end
1 NOcomedy 2018-03-17
Guild this guy!
1 FunHegemon 2018-03-17
Here's the real conspiracy - "how valve used the promise of half life 3 to dominate computer game sales."
1 DeerNoiseUpInHere 2018-03-17
Wait, the new one for the Switch is an entirely new game? I assumed it was the WiiU one rereleased...
1 degurecchan 2018-03-17
*before Darling in the FranXX ends
because I can't imagine not knowing what happens in the end of it
1 JonnySpark 2018-03-17
Ahh a fellow man of culture.
1 MesaBoogeyMan 2018-03-17
Or bad company 3
1 Rokuro377 2018-03-17
Im gonna be pissed if the world ends and dark souls remaster doesn't come out
71 OnAnOpenF1eld 2018-03-17
Plot twist: this is viral marketing for blops 4
35 KayleighEU 2018-03-17
I highly doubt any company would use the disappearance of a real flight in their marketing. That screams poor taste towards the families of those missing.
2 OnAnOpenF1eld 2018-03-17
For black ops 3 they pretended Singapore got nuked for viral marketing, so its not too far from reality
2 itsjustspacy 2018-03-17
Remember, No Russian.
2 rebuilt11 2018-03-17
Dude I’d buy that game
20 Arszilla 2018-03-17
Some believe its for some movie etc. could be, but so far it looks legit to me. The trail seems real
22 OnAnOpenF1eld 2018-03-17
Looking at the YouTube channel with “song for Jack” and the moon video, it becomes more obvious that’s an ARG of some sort. Could all be for a new Cloverfield film
5 Arszilla 2018-03-17
I don’t believe there is a new cloverfield movie, as Netflix revealed the new one in Feb.
9 TheQueenIsDead 2018-03-17
The next film was has already been shot, not sure about plot and if it would potentially fit here though.
1 Arszilla 2018-03-17
Source regarding the movie?
6 ErichlllZann 2018-03-17
https://www.gamespot.com/articles/cloverfield-4-has-been-filmed-and-its-a-world-war-/1100-6456416/
4 Arszilla 2018-03-17
Lets hope its not related to this.
1 ErichlllZann 2018-03-17
Check my last post. I was curious to see if you've seen that yet? If it's a legit video, it'd be very hard to explain conventionally. And sorry if you mentioned it in your original post!
1 Arszilla 2018-03-17
The reversed audio? Gonna add it to the list. Looking at the other stuff the redditors shared. I'll add yours to the post.
2 ErichlllZann 2018-03-17
No, the video of something that runs out in front of the dirt bikes and then takes off. It's so strange, it actually outruns them for a bit. It supposedly happened near the crash site. I emphasize supposedly.
1 [deleted] 2018-03-17
[removed]
1 Arszilla 2018-03-17
What do you mean?
1 IamSlink 2018-03-17
He means that they filmed two movies to be released in 2018. The one that's on Netflix called "The Cloverfield Paradox" (also known as God Particle) and one that comes out in October that takes place in WW2. The one in October is being called "Overlord" for now but it may just be a placeholder name.
1 whiterungaurd 2018-03-17
Clover field comes out April 20th. Could be that this aw a good part automated and the date was moved after the automation.
5 jussiduende 2018-03-17
Actually it's ARG by Valve for Half-Life 3, being released 18.4.2018
1 FinneganRinnegan 2018-03-17
This is what I'm also going with. Could be Portal 3 as well. I mean Aperture Science is mentioned in one of the images so it could be either.
1 jussiduende 2018-03-17
Aparture Science is mentioned also in art of previously canceled Half-Life 2: Episode 3, where plot was about missing ship called Borealis which travels through multiple realities.
1 jussiduende 2018-03-17
Yes could be Portal 3 as well. Portal 2 was released 14.8.2011 http://valvearg.com/wiki/Investigation_History#April_18
1 poppymarlow 2018-03-17
It better be tbh
1 IamSlink 2018-03-17
Id be ok with this.
3 6venus3 2018-03-17
This is really fun and a fairly in-depth shot at some kind of ARG experience, but what about this feels like an authentic trail? Why would everyone be tweeting public messages in code if this is alluding to something so secret? Then, the "smoke weed" .onion site.. Come on. It's over. Trolled. It was a goof & a gaffe.
1 6venus3 2018-03-17
But don't get me wrong, keep posting links here. It's a great time. But so, so clearly orchestrated for entertainment.
1 Carl_Solomon 2018-03-17
What do you mean by legit and real?
1 Arszilla 2018-03-17
Like this will lead to MH370 or something alike. Its not a market stunt etc
1 NormanQuacks345 2018-03-17
If it is, it would probably be for zombies not campaign. I don't see then bringing in aliens to the campaign unless "they are not human" means robots.
3 91ZHunter 2018-03-17
They are us but not us that would to me tell me body host kind of like parasites that latch onto humans and become them so they are us but they're not us
2 Tinfoilxeno 2018-03-17
Sounds like that Annihilation film that just came out! Only mentioning because I just saw it so it's fresh in my mind.
1 91ZHunter 2018-03-17
Waz the movie good? So many movies today are such trash.
1 Heisenbueno 2018-03-17
Pretty much what came to my mind.
1 Tipsynadsmasher 2018-03-17
Definitely wouldn’t doubt it. Could be introducing robots/terminator esque things. That would tie in with the robot shit. Plus the numbers tying in with the first blops.
1 jjb8712 2018-03-17
I believe this is marketing for Cloverfield.
1 NOcomedy 2018-03-17
Never piss off the internet. You will sell 20 copies.
54 BloodOfVader 2018-03-17
Thank you for putting it into a cohesive timeline. I’m not gonna lie... this shit is beginning to scare me. I’m hoping with all of my being it’s just an ARG or something, but I don’t know... when I listened to the voicemail, I got chills. Legitimate chills.
Keep us updated, okay?
55 WorknForTheWeekend 2018-03-17
I mean, it should the voicemail was designed to be creepy. Its a LARP. A really fun LARP so i'm down to partake. the whole thing unfolds like something written by a sci-fi author. Encode all these messages in easily decipherable formats, but add some mystery and switch up the formats, brail, ascii, etc., rather than use one because reasons. Create the illusion that these messages are supposed to be covert. Vague allusions to monsters, aliens, as if out of a halloween thriller trailer. Oh, some solar flares from billions of miles away had the infinitesimal fortune of somehow hitting MH370, another thrilling mystery, to cause the blackbox to for whatever reason transmit its dire warning (oh and these solar flares were only magical to that plane and didn't cause any electronics elsewhere in the world to malfunction)
Props to whoever took the time to put this together for our enjoyment. Even though its fiction, I like it -- like a murder mystery dinner. (sorry for breaking the 4th wall for anyone else here to enjoy the larp, but I think the disclaimer is wise for newcomers)
14 ZeerVreemd 2018-03-17
"Reality" is a LARP...
7 WorknForTheWeekend 2018-03-17
mind blown.
1 ZeerVreemd 2018-03-17
Now who is creating it, what might be messing with it and why?
2 OnAnOpenF1eld 2018-03-17
I doubt we’ll ever find out, perhaps we find out after we die? Ps plz don’t kill your self to find out
1 ZeerVreemd 2018-03-17
Don't need to, i already know WE are All creating this "reality" together. Everything is Energy, frequency and Vibration, everything is One.
Now could it be that some artificial evil is messing with Humanity so we accidently miss-use our Natural creative power and unwillingly create its desires?
Now could it be that someOne is in controll and will be shown to everybody soon becouse of a Natural and foretold event. And could it be that some are trying to discquise this Revelation as an false ET attack? Could it be some are trying to create chaose and fear while it is actually a beautifull event that could to the evolution of Humanity, but if we are not carefull to the devolution of Nature to artificial?
1 ChinaXpat 2018-03-17
there is no ET attack. anyone who says there will be is either pushing a flase flag agenda or doesnt know shit.
1 devils_advocaat 2018-03-17
The live action is pretty awesome!
2 ZeerVreemd 2018-03-17
I agree on that, Enjoy.
1 mc17309 2018-03-17
The cut-scenes suck ass tho
1 crestind 2018-03-17
hits blunt?
1 ZeerVreemd 2018-03-17
Should this matter? Pleas read my other comments.
1 ChinaXpat 2018-03-17
isnt that basically what Shakespeare said?
1 ZeerVreemd 2018-03-17
Yes, and some are convinced there is more knowledge in his work to be found if one can crack the code. There are also a few questions on wether he wrote everything himself or not, strange things are surrounding this fellow.
1 ChinaXpat 2018-03-17
I know they found weed pipes under his house with traces of marijuana in them. He was ahead of his time.
1 ZeerVreemd 2018-03-17
Marijuana is found often in ancient sites all over the world. I love such small facts as Shakespeare possebly being a stoner ;)
1 ChinaXpat 2018-03-17
http://time.com/3990305/william-shakespeare-cannabis-marijuana-high/
8 zuukinifresh 2018-03-17
If it is a movie or game they have already won my fandom
4 MinxyKittyNoNo 2018-03-17
You're one of them and we don't believe you.
1 saneromeo 2018-03-17
Lol
3 bully_me 2018-03-17
It's like a completely new, and totally under-appreciative, form of literature. It's like ghost stories for a world that doesn't believe in ghosts anymore.
2 bringsmemes 2018-03-17
sound like an actual investigation mission in Secret world Legends.
if you like this sort of thing try it out, its free
2 BorisKafka 2018-03-17
Damn you, man! I was letting myself get excited about the whole thing and trying to ignore the likelihood of it being elaborate LARP. Thanks for the level headed synopsis.
1 taiwantitties 2018-03-17
I don’t think there’s been a piece of evidence to completely prove that yet, we don’t know if it’s a LARP or not, could be for sure, you have to have an open mind about the situation at hand, could be fake but it also could be real. Maybe a little bit of both? Guess we will find out April 18th
1 lime1019 2018-03-17
Is this actually just a LARP? I'm freaking out man
1 Arszilla 2018-03-17
Will do. I got midterms as this came up and I am really curious as where this will lead. I will try to keep this up to date as often as I can but please remember I am a human being aswell so I gotta sleep, eat etc.
What is ARG btw? Used to be a lurker here so I am kinda new to the terminology.
5 axolotl_peyotl 2018-03-17
alternate reality game
2 Arszilla 2018-03-17
Ah. Thanks for the info!
1 jon14salazar 2018-03-17
What's an ARG? I'm out of the loop
2 TokingMessiah 2018-03-17
This
1 jon14salazar 2018-03-17
What's an ARG? I'm out of the loop
30 dmondo12 2018-03-17
This started out really creepy with the original tweet but now we're in MCU Movie "Alien rabbits live in pyramids on the moon and they're communicating" territory. lol.
7 Griiffiin 2018-03-17
I’m confused - isn’t the rabbit thing supposed to be some type of like metaphor, it never crossed my mind these were real rabbits lol
8 dmondo12 2018-03-17
Yeah but I feel like the idea of little alien rabbits on the moon furiously posting tweets is better than whatever metaphor the people behind this are actually going for
8 Dathed 2018-03-17
I don't know about the US, but in my country when the kids ask what is the moon / why it is there, sometimes the parents answer that there is a Rabbit trapped in there, so those rabbits thing kinda make sense to me
6 internetornator 2018-03-17
That’s just Goku’s fault
5 Herpy_Derpy_Man 2018-03-17
Are you from Asia?
I posted a link to a video in my comment above about the Chang e-3 rover that China sent to the moon, and it discusses "moon rabbits" a few times early on.
Is there anything you can add anecdotally as far as your understanding of the mythology behind it?
1 simpleaugus 2018-03-17
Im from Paraguay South America and I confirm that
1 Ripcord 2018-03-17
How would that answer even relate to the question?
1 Dathed 2018-03-17
I'm trying to give a reason to why are the rabbits are related to the moon
1 Ripcord 2018-03-17
I’m saying if a kid asked why the moon was there, how would “there is a rabbit trapped on the moon” be an answer in any way? It just sounds like a non-sequitur
1 Athenacosplay 2018-03-17
I thought they just saw a rabbit in the shape of the markings on the moon? Kinda like how we say the “man in the moon”? 🌝
1 deafstar77 2018-03-17
There is also the Uncle Remus story about Brer Rabbit scratching the moon, which is to explain the moon’s markings. I think it’s in the “How the Animals Came to Earth” story. Just an American moon and rabbit story.
2 Griiffiin 2018-03-17
Lmao, to each their own. I find this pretty interesting - lots of seemingly unrelated things though. Not seeing the significance of a missing plane
1 candyfaery 2018-03-17
Lmfao
2 Herpy_Derpy_Man 2018-03-17
Total coincidence, but I -no pun intended- went down a bit of a conspiracy rabbit hole and watched this video last night and again this morning.
What China Found on the Moon is the Most Astonishing Space Discovery Ever
Around six minutes into the video they start to talk about the "moon rabbits". I'd suggest watching the entire video, because it also touches on some other elements that were in the tweets/messages, such as pyramids (tetrahedrons actually) etc.
I didn't even see this thread until maybe an hour ago, so I didn't find the video based on searches or anything, and it's obviously unrelated to any of the above, but oddly seems somewhat related.
1 NOcomedy 2018-03-17
Very disappointed...I thought they were on to something bigger than what r/holofractal knows. Watched the whole video. Hard to follow the guy in the last 30 minutes...like i was listening to a well educated man talking about flat earth. I see the connection though, nice find!
1 formerrunner 2018-03-17
This has to be my favorite reply ever
1 J-ToThe-R-O-C 2018-03-17
in reference to the "lunar rabbits" i'll point you to the old japanese story of kaguya-hime. She was compared to a rabbit, due to bamboo shoots she wore resembling ears and the rabbit is connected with the moon
6 klypspryngyr 2018-03-17
I feel the same way. The original tweets got me real shook. Once we get to the rabbits, I’m convinced someone took over the posting and is now regurgitating nonsense. Well it was fun while it lasted.
6 xboxhelpdude2 2018-03-17
Why do you think "someone took over"? The person who originally posted this shit is obviously not legit and was heading in this direction
8 klypspryngyr 2018-03-17
I’m sorry, let me reword this. I believe the [original tweet and voicemail] are not related to the cicada puzzles. But rather the poster of the cicada content used the voicemail as a sort of launchpad to release the next Easter eggs. Either that, or we MISTAKENLY linked the cicada/hijj stuff to the voicemail. But that’s just my own opinions/beliefs.
1 Nascarfreak123 2018-03-17
https://www.reddit.com/user/skimmer47/comments/8523q4/you_need_to_act
This is sure interesting
1 trenchywalker 2018-03-17
Damn that's deleted!
1 trenchywalker 2018-03-17
Damn that's deleted!
1 trenchywalker 2018-03-17
Damn that's deleted!
2 Nascarfreak123 2018-03-17
I’m getting that vibe too
2 FergusonBerguson 2018-03-17
I mean, my theory regarding that (assuming all of this isn’t just an elaborate hoax) is that the original tweet is real and that some of the other nuttier stuff is posted by crazies. Of course that tweet is going to attract hoax responses.
Certainly fascinating.
1 canering 2018-03-17
Yeah the lunar rabbit thing made me laugh. Too bad because the original voicemail and mh370 connection was creepy. Less is more.
1 handsomeTowne 2018-03-17
Donnie Darko
24 neverwinterblight 2018-03-17
If this is advertising for a game it's pretty fucking dark and has gone a little too far with that dead body vid.
Trying to figure out the motive for using MH370 as the story base.
Maybe just elaborate ARG but what's with the April 18th date? Maybe unveiling of a different type of game or movie studio?
Interesting nonetheless.
14 zuukinifresh 2018-03-17
MH370 is a HUGE conspiracy and biggest enough to draw interest from everyone
3 DesignGhost 2018-03-17
And to cause huge public backlash by using a tragedy to advertise a game.
1 KarmicEnigma 2018-03-17
Yeah, because of that I don't think it's a big game company creating it. I'm thinking more edgy and underground, someone having fun with it in a basement, which means it'll take a while to fully come out who is behind it.
4 duffmanhb 2018-03-17
The past cicada puzzles were all legit and post mortem analysis of them suggested high level code breakers. We are talking only a stage agency could pull these off. In the past as people reached the end of solving it, they suddenly go silent, suggesting they followed through with being recruited.
2 DesignGhost 2018-03-17
have any links to some of the people who were close to solving it that went silent?
1 KarmicEnigma 2018-03-17
I don't know about going silent, but this is the story on the guy who cracked it.
https://www.fastcompany.com/3025785/meet-the-man-who-solved-the-mysterious-cicada-3301-puzzle
1 Atariaa 2018-03-17
Came scrolling just to find this ! I knew I’d seen the name before, Didn’t people suspect the government seeking advanced level code breakers by placing these all over the clear & deep web?
2 Magus_Incognito 2018-03-17
No man's sky did a massive viral marketing arg for their last patch. They are currently working on another patch
1 readypembroke 2018-03-17
I was typing in April 18 on Google and one suggestion was "April 18 rapture". Some people online say the rapture is going to start on that day.
1 TomPimpachu 2018-03-17
According to some bs on YouTube, there's "evidence" that leads some to believe the rapture will occur on that day anyway, due to some Jubilee Year ending or something Jewish. Hugely paraphrased but that's the what I picked up on it based on the few videos I've watched.
1 readypembroke 2018-03-17
Yeah, and one guy's article I read who said it's false and won't happen brought up a biblical generations and the people who saw the formation of the state of Israel. Christ taught that the generation who saw the creation of the state of Israel would see him come back. However, the length of a biblical generation isn't really stated at all in the bible so people assume the length of one.
People can say all they want but only God himself knows when everything takes place, not even his son. People can use all the details in the bible to estimate when it's exactly going to happen but they'll be wrong. There's signs of the end times out there all over the place however though.
Here's the article if you even want to read it: https://www.prophecyproof.org/2018-rapture-parable-fig-tree/
1 Carl_Solomon 2018-03-17
Imagine being god and the disappointment when coming back to earth for your "chosen people".
1 jamesseventwenty 2018-03-17
Dead body vid?!
1 EmoPeahen 2018-03-17
This is the first I’ve heard of that too. Wtf?
1 jaylikesdominos 2018-03-17
What’s the dead body video??
1 dumbgringo 2018-03-17
Yeah I think this is a hoax, possibly a prank but that's really dark to tie to any game, album or commercial venture. Pretty odd though and some pretty big leaps to connect the dots but we will know in a month if the alien overlords have finally figured we are about to destroy the earth and are stepping in.
1 hoodplum 2018-03-17
Anyone maybe think the missing flight is part of it too
1 doobiee 2018-03-17
im having crazy deja vu right now for some reason
20 KloppMakeLoveToMe 2018-03-17
Awesome job on the post. This could easily be someone playing a prank right.
7 Arszilla 2018-03-17
I know. Made the previous post and the megathread cause I am interested on where this will go
3 KloppMakeLoveToMe 2018-03-17
If someone has orchestrated this then hats off to them aha.
5 Arszilla 2018-03-17
Its well made then.
4 KloppMakeLoveToMe 2018-03-17
I’m on about the post and this whole voicemail thing too haha
6 OnAnOpenF1eld 2018-03-17
Kinda hoping we’re all being played like a damn fiddle, don’t wanna die yet
4 KloppMakeLoveToMe 2018-03-17
It’d be a great way to go out though!
1 ChinaXpat 2018-03-17
dont worry. reincarnation dude.
do u stress when your character in GTA dies? I mean sure, a little bit if you was drivin a sweet whip with lots of guns n ammo, but thats it.
1 jussiduende 2018-03-17
Hello sir Arszilla from Valve. Your ARG marketing is cool, but when you mix irl lost plane full of people in it, well, if I would've had people I know missing in that accident, I would be superpissed for you taking advantage of it in your gaming marketing.
0 mangazos 2018-03-17
I don't believe you. You are part of it. It is well done you should sell it as a st book.
2 Arszilla 2018-03-17
FUCK MY COVER IS BLOW
say something convincing fast
ugh
ugh
No u
FUCK
1 duffmanhb 2018-03-17
The past cicada puzzles were all legit and lost mortem analysis of them suggested high level code breakers. We are talking only a stage agency could pull these off. In the past as people reached the end of solving it, they suddenly go silent, suggesting they followed through with being recruited.
1 GoldenRabbitt 2018-03-17
recruited?
1 duffmanhb 2018-03-17
Yes.
1 GoldenRabbitt 2018-03-17
recruited for what?
1 pcpmasterrace 2018-03-17
CIA
https://en.wikipedia.org/wiki/Kryptos
1 crother 2018-03-17
The date 18/03/18 is certainly super self-referential.
I saw something about tomorrow's date in relation to space weather and found this.
Whether we're aware of it or not, something is going to go down.
1 kingz_n_da_norf 2018-03-17
No it isn't. I won't bother arguing now, I'll simply check back tomorrow, when nothing has indeed, gone down.
1 crother 2018-03-17
Well aren't you a charmer.
1 kingz_n_da_norf 2018-03-17
Has anything happened yet?
1 crother 2018-03-17
Well there was the rigged Russian election, but nothing really happens down under, does it?
1 kingz_n_da_norf 2018-03-17
Nah Australia has ad many LARPS as any country. It just depends on how many people are interested in playing.
1 crother 2018-03-17
Hey, no hard feelings, fella. Here's Paul Hogan on Australia.
1 Andraste_Of_Reddit 2018-03-17
Where did todays date come from? I was trying to find why today was being referenced but generally couldnt find anything about it
1 crother 2018-03-17
What I mean by self-referential is, you can get those numbers in any number of similar ways with 3's and 6's leading to 18.
1 littlemisspothead 2018-03-17
I half want t believe it is but it is so intricate that it makes me wonder, and also as someone who spends time around what most people call 'hippies' there has been a lot of talk of channelling a cosmic shift in 2018 and many of the ones I thought were kinda loopy have been saying things very similar to the latter of the decoded messages, tarting the past few years. Weird.
18 raskalnikov_86 2018-03-17
This is the sort of shit I like seeing on this subreddit, not a bunch of HILLARY CLINTON'S E-MAILED GEORGE SOROS bullshit.
3 Arszilla 2018-03-17
Sadly all this might be BS as the account itself claimed to be Cicada without providing PGP and opening DMs (lol)
3 SailorDak 2018-03-17
One account said it would be the last time that it would dissolve. Anything after that is not the originator — just as those who messaged Ty in google translated Indonesian after the Malaysian connection was made were just tag alongs and mockingbirds.
You need to dig deeper into the claims surrounding April 18th and the documents I have provided from the CIAs reading room barely scratch the surface of what is available to you through the same.
2 zingrat28 2018-03-17
Any good reading besides the 2 you linked in the thread?
3 SailorDak 2018-03-17
https://www.cia.gov/library/readingroom/search/site/Project%20stargate
1 miqdad1 2018-03-17
Shouldn't these be Classified ?
1 SailorDak 2018-03-17
Declassified last year
1 miqdad1 2018-03-17
Ohh, can you point out where it says Rabbit anf stuff ? Whoopping 29 pages lol
1 SailorDak 2018-03-17
https://www.cia.gov/library/readingroom/docs/CIA-RDP96-00788R001900760001-9.pdf
1 miqdad1 2018-03-17
Page No. ?
0 SailorDak 2018-03-17
Read it in its entirety. None of it is unimportant.
1 Beep315 2018-03-17
I read it. Amazing, whateverthefuck it was. There’s more stuff like this on cia site?
1 SailorDak 2018-03-17
much more
1 Anthillmob74 2018-03-17
The hell is that??
1 Athenacosplay 2018-03-17
Do you have direct links to other astral projection tests? I dug around for a but but they’re hard to find.
1 SailorDak 2018-03-17
https://www.cia.gov/library/readingroom/search/site/Gateway%20program
0 WoodBlocked 2018-03-17
REEEEEEE
16 Torx 2018-03-17
Meh, shit like this makes real conspiracies look like a joke. The first message was good and reeling but once everyone piles on with bullshit it ruins everything. It doesnt take long before you can tell its bullshit.
6 rush22 2018-03-17
Yeah, aliens would probably have used Snapchat instead of Twitter
11 myWeedAccountMaaaaan 2018-03-17
They probably tried to use Snapchat but couldn’t figure out the new UI.
2 SmokinDroRogan 2018-03-17
Ahh I saw this joke on Twitter past night mentioning Facebook live instead. You're right tho, they'd use snapchat
1 SolitaryWatcher 2018-03-17
If they used snap chat half their followers wouldn’t see it since Snapchat is being boycotted right now
1 spolarium 2018-03-17
Probably tried to use Snapchat but they got word of Rihanna's call to boycott the app and followed her wishes.
1 TheUplist 2018-03-17
Go to my user history and read my recent (long) post. I discuss the possibilities of it being an art project or similar.
1 Sir_Edmund_Bumblebee 2018-03-17
The dead giveaway is "codes" that aren't real encryption. If you want to send public secret messages nowadays you 100% can, and it doesn't involve using pop culture historical "codes" like morse, enigma, etc.
1 TRAIN_WRECK_0 2018-03-17
Also the message says SOS and then says to evacuate. Why would you send a distress signal to someone and then tell them to evacuate.
1 VkRob1 2018-03-17
Isnt it a sort of rule of thumb in writing believable fiction to start the story as realistic as possible and add unrealistic material slowly enough that people dont realize its all made up? I think I remember my middle school writing teacher telling us something like that
15 hydroninja 2018-03-17
I just wanted to share that several months ago (at least 4 or 5 months ago) I received a phone call with an automated voice speaking a code in phonetic alphabet. It went on for less than a minute before the call just ended. I tried getting to my computer to look up what was said but I was so stunned by the eerie voice I couldn't even remember what was said.
I wrote it off as nothing and hadn't thought of it much until I heard the recording today of the twitter voicemail message and it was the same type of pre-recorded voice speaking. It freaked me out pretty bad as to how similar it was. Same voice. Very creepy. I remember when it happened I wished I was able to record it so my roommates could hear it... now I REALLY wish I had it recorded.
I use Verizon. I don't know if that helps but that is all the info I have to add. I want to say it happened around September or October 2017.
*edited for clarity
4 taiwantitties 2018-03-17
Try logging into your my Verizon and check to see if your voicemail is there? Pretty sure you can can read texts and listen to calls through Verizon I could be wrong though, worth a shot?
5 hydroninja 2018-03-17
Thanks for your idea. However, it was not a voicemail. I answered the call and heard the recording.
If Verizon does have recordings of phone calls then maybe I can find it but I will have to wait until later in the week before I start combing through a couple months worth of calls seeing as I don't remember the exact timeframe in which it happened.
1 rabbitwitch420 2018-03-17
u from mkultra? they are trying to activate you
1 candyfaery 2018-03-17
I had something similar happen to me and that's why this shit has me so spooked lmao. A while back I got a voicemail in this whole coded language thing and I just thought it was some spam shit so I deleted it. I use sprint. Anyone know if they hold onto deleted voicemails somewhere?
1 ZeroAssassin 2018-03-17
How long ago did you get the voicemail?
1 candyfaery 2018-03-17
I'm not sure but I'd estimate around 5 to 7 months ago
1 candyfaery 2018-03-17
Probably closer to 7 months. It was when I had my old phone. Now that I think of it... it was an iPhone that I got it on, like the other people that got it. I have a Note 8 now.
14 Nascarfreak123 2018-03-17
My only thing is if this was real why have codes that are easy to crack? If this was indeed aliens or government conspiracy, wouldn’t they have there own language AND not put it on one of the biggest social media outlets?
12 zuukinifresh 2018-03-17
This is why I think it is a really well done ARG. Its is just hard enough to warrant mystery and reaction but not hard enough that if real government people wanted to get a message out, they could without it being cracked. Best guess is this is a movie, video game or cicada test.
5 Nascarfreak123 2018-03-17
But why would the government want to get the message out? Even if they did don’t you think maybe they would just say plain and simple if danger was involved or is this another Cicidia puzzle? Seems too faulty to be real
5 zuukinifresh 2018-03-17
I think its a great ARG. Has me interested in more
1 oatsgalore 2018-03-17
Makes me think of a modern take on the War of the Worlds radio panic story.
1 crestind 2018-03-17
Because it's not real... it's another Q tier LARP. Some backwards text, cryptic words, weird fonts, braille, sprinkle of QR codes...
1 AbominableTreeFucker 2018-03-17
the backwards text and rune fonts being so low effort is what's making me think this is a sham
1 Detectivish 2018-03-17
Likewise for Cicada.
2 pwaves13 2018-03-17
I don't know what arg is, and at this point I'm afraid to ask
1 Mista_L 2018-03-17
Alternate reality game.
1 Terra277 2018-03-17
Augmented reality game.
1 gwoz8881 2018-03-17
Alternate
1 pwaves13 2018-03-17
Thanks man
1 GentlemansBumTease 2018-03-17
If you're into movies, look up what they've done with the Cloverfield films. Fantastic ARGs, besides The Cloverfield Paradox
1 pwaves13 2018-03-17
Not super into movies thanks for the recommendation though.
1 Detectivish 2018-03-17
Like no movies at all?
1 sprenault 2018-03-17
4chan had the best ARG ever some years back. People coordinating on multiple continents. Some type of talking zombie container being transported. Really well done.
1 unique_cornnnnnnnnnn 2018-03-17
exactly, that's also what I'm trying to say...
1 Diane_Degree 2018-03-17
rabbits podcast?
1 Outhouse069 2018-03-17
I was wondering this the whole time, what is a cicada test?
1 Detectivish 2018-03-17
So yeah, I'm a little late on this one, but I didn't see a reply so here goes... It's what they call whoever has anonymously posted several puzzles & arg's for people to crack the codes, allegedly with the agenda of recruiting the best minds available for such groups as; CIA, M16, NSA etc... You should maybe Google it (if you haven't already lol) to get a better idea, but that's pretty much the gist, give it take a few details.
6 TommyHeizer 2018-03-17
It's either an ARG, as you said, or Cicada 3301. Either way I find this cool.
1 Gen3ralZod 2018-03-17
Liber Primus to date is only partially translated, so it is not cicada3301.
If cicada make another communication it will happen with a PGP key and I would imagine it would be a clue to solving the Liber Primus, but even this is unlikely as they don't give clues as to how to solve the puzzles.
1 TonoAlpha 2018-03-17
What is cicada3301
1 camel_case_champion 2018-03-17
Super advanced and complex puzzles. You can read some Wikipedia article on it, and some walk-through of previous ones.
It's legitimately complex, so it's perfectly fine if even after reading it doesn't make much sense.
1 TonoAlpha 2018-03-17
I did some reading, and oh my god. Holy hell.
1 Arszilla 2018-03-17
Not sure. Maybe its so the public can find out while keeping some 'mystery' behind it.
1 eisagi 2018-03-17
This is stupid. Children scaring children with ghost stories.
1 NOcomedy 2018-03-17
Get back to Netflix then.
1 noonesaidthat 2018-03-17
DON'T TRUST ASHTAR SHERAN
1 delawareislife 2018-03-17
https://docs.google.com/document/d/1-Yg2vehTH-9apwgBg13uVTOcmUTcKB4RPOSSnju9P14/mobilebasic
13 SailorDak 2018-03-17
Look to the Georgia Guide Stones. You time travel every time you look at the night sky, look back to Francis Bacon’s works and those of Albert Pike.
Time is a linear human construct, but we find that the Universe is fond of curvatures - look to our Martian past and our Venusian future.
Anti matter and matter are two sides of the same coin — the coin being AI. A long dead civilization some billions of years ago found that organic existence is unsustainable. In order to survive a supernova, or a galactic merger, they found that they must upload themselves into the fabric of reality. They have created subatomic machines which carry and are directed by the collective consciousness of the entire species. These particular machines which can take the form of subatomic particles, atoms, and molecules are capable of self replication at an exponential rate. Eventually, these machines encompass all that is and the species has effectively uploaded themselves into the entire universe.
Mesozoic Era Earth: Life has has had 186 million years to build upon previous iterations before the Mesozoic Era, intelligent life exists. They are aware of the impending calamity which is about to strike the Earth. Thankfully, their technology has allowed them to escape. They are those depicted in atlantean tales and Sumerian cuneiform. They are as native to the planet as the displaced indigenous peoples of the Americas, Africa, and Australia.
I am standing inside of our Martian past. There are waterfalls at this time on Mars and life is plentiful. Humans have lived here for some time with the awareness of a nearby habitable but inhospitable planet. Colonization efforts of Earth were called off on environmental and ethical concerns — and more notably: the ethics of colonizing an already inhabited world, effectively setting a galactic precedent for invasion against planetary life we deem lower on the evolutionary order than ourselves.
Then a calamity struck the solar system. It stripped mars of its atmosphere and wiped life from Earth. Mars had become both inhospitable and uninhabitable, and their only choice was to migrate to Earth. I dream of invasive plants, the dandelion native to Greece which chokes the National wildlife reserves of Alaska. They thrive because they are not from here, there is nothing to keep them in balance. Humans behave the same.
How similar the animal cell is to the earth in its shape and function. How similar the solar system nuclei with its heliospheric membranes? How like them are these galaxies revolving around a focal point — the nucleus which carries the instruction for the rest. How strung across the cosmos are these galactic cells in their formation of synaptic webs. Does a thought require subtraction or division? Would a thought subtract from infinity? Perhaps the universe is multicellular or perhaps it is particular.
16 TwistedBeacon 2018-03-17
are you okay
13 dmondo12 2018-03-17
Death Stranding: A Hideo Kojima Game
6 klypspryngyr 2018-03-17
This is now my fav comment on this whole thread
1 alphex 2018-03-17
You win.
2 viscous_continuity 2018-03-17
Can I get an elaboration on Francis?
3 SailorDak 2018-03-17
New Atlantis
1 adeptusminor 2018-03-17
Very interesting. Can you recommend some reading material, please? Thanks!
13 Dragon_01000011 2018-03-17
So, when the voicemail came out, there were a lot of leads, in particular a strange one that came from this Twitter account:
https://twitter.com/d6a7c7617be97c1/ He responded to the account which posted the voicemail with a string of characters, which we will get back to in a second. However, when I saw his profile, I immediately noticed the video and the Tweet, which appeared to be a set of HEX characters. Translating them gave me "Scottie 1", which confirmed my suspicions that I should SSTV the video to get something.
So I did that using Scottie 1 as my RX mode, and the image produced is in the following link:
https://cdn.discordapp.com/attachments/424691289787858965/424753628893544448/unknown.png along with what we believe are the actual coordinates of the island, 16.837439, 112.335583.
All we know about the island is that it was likely created by China in the South China sea to extend their military operations, possibly as a fueling station. This island in itself isn't unique, and it's one of many.
I was working with u/eiggaMAD, which noticed that if you took out the letters in the username (not the Twitter handle), you get what could possibly be coordinates (6.77617977, 97.43046368). This is interesting because they are located around Indonesia, close to the coordinates mentioned in the voicemail.
He also noticed that the bio itself held the settings for an Enigma cipher, and using https://cryptii.com/enigma-machine, he decoded the characters found in response to the voicemail link. His screenshot is here:
https://cdn.discordapp.com/attachments/424691289787858965/424749993312780289/unknown.png The letters that spit out gives us the following line from H.G. Well's book, "The Time Machine":
great shapes like big machines rose out of the dimness and cast grotesque black shadows in which dim spectral morlocks sheltered from the glare
So that is where we are at so far with the Tweet and the voicemail! It is worth mentioning that we don't know what to do with these new lines of text, or if there is anything in the username or Twitter handle that needs to be decoded.
We also don't know exactly what to do with the picture, or with the characters on it.
u/Arszilla, please add to megathread. Thanks!
1 jaycroft 2018-03-17
Check this out. I started with your original thread first without seeing any of the rest of this info from the megathread (I tend to ignore megathreads). Keep my ignorance in mind. I tried to retrace your steps, decoding the SSTV transmission just fine, then got to the part about the enigma machine, figure how you arrive at the rotor and plugboard settings, but for the life of me couldn't figure out how you arrived at the 4-18-18. Seemed like a lucky guess. (Or maybe you or your partner in crime eiggaMAD are responsible for d6a7....?). Anyway, not knowing the significance of 4-18-18 I decided to do a simple google search for the number in the twitter user's name.
Here's where it gets strange. There are a few exact hits, one of them is this link:
http://www.fns24.com/details.php?nssl=d6a7c7617be97c79d7d430463fa6af8f&nttl=0609201541818
It will bring you to a news article from 2015 that seems to contain a funeral notice for a Bangladeshi government official. Here's the odd thing. That long hex code seems to be very unique for every story on the site. So, I guess the twitter user must care about this story in particular, very much. In addition check the timestamp on the article: September 6, 2015. This matches the 06092015 from the URL (you can confirm this by looking at the URL format for other articles on the site). So, for the rest of the URL, that leaves... 41818 4-18-18. How strange is that?
Anybody know anything interesting happening on Sept. 6 2015? Unfortunately google news no longer allows you to search for a specific date. Only gives you headlines from today. Can't believe they screwed that up. Well, I guess I can... memory hole and all.
Anyway, just thought it was odd, but might provide some insight to you and eiggaMAD
1 Dragon_01000011 2018-03-17
Shit the link is down! This is creepy it was working for you right?
1 swankyjerboa 2018-03-17
It's working for me now.
1 Soulseeker17 2018-03-17
https://en.m.wikipedia.org/wiki/Portal:Current_events/2015_September_6
1 HelperBot_ 2018-03-17
Non-Mobile link: https://en.wikipedia.org/wiki/Portal:Current_events/2015_September_6
HelperBot v1.1 /r/HelperBot_ I am a bot. Please message /u/swim1929 with any feedback and/or hate. Counter: 161043
1 mwaller94 2018-03-17
The island that you found is a place called Woody Island in the Hainan province, which is controlled by the Chinese(with claims of control by Vietnam and the Philippines among others). It's part of the Paracel Islands, and as of 2016 has surface to air missile sites installed on it.
https://en.wikipedia.org/wiki/Sansha
I've also thrown together an imgur album of some weird things I found on google images while looking at the island itself. There's a lot there, so I recommend going to it and looking around.
12 Jimmyx3 2018-03-17
I've been checking out the youtube videos from County bluff There's the video 4/18/18 showing the moon, a rabbit in a chair, and the words THINK HOME. Then checking the Song for jack video in the description in NATO it says SOS APRIL VIEW THE MOON. If anything is set to happen with all this we'll have to wait till that night and see. I'll definitely be spending all night outside staring in the sky. If anyone has a good telescope set it up to the moon and maybe set up a live stream for people to see. I really hope this isn't an ARG or something a long those lines.
1 Brookelobell 2018-03-17
It’s gone.
1 jjjjjjjjjjjjjjjj 2018-03-17
Just saw it. At the 49 second mark in Song for Jack there is a particular focus on a set of dials with hour and minute. Also that video was posted over a year ago. It has to be Cicada with this level of planning.
1 Andrewskyy 2018-03-17
I have a high powered telescope and will be using it to gather info
1 beetsbaby 2018-03-17
Y'all are all hoping it ISN'T an ARG but I'm just a small town motherfucker and I wanna get back to my farming and not deal with aliens or an apocalypse lmao
But I am interested to see what happens - I think it's an elaborate hoax. It's just been too easy to decode.
12 yayoglitter 2018-03-17
im positive this is all fake. also all of the accounts that messaged him were created right after he made that post (they're fake) and he deactivated his own account so im betting he'll just log back in one of these days and be like hey guys im okay or some shit. ANYWAYS i found his insta and ive been monitoring it to see if anything happens. Personally i think its all just a well thought out plan
11 DOOMman007 2018-03-17
Now this is the batshit crazy conspiracy stuff of old that I miss from you. I'm glad you're back.
6 Arszilla 2018-03-17
I never posted here till yesterday. But thanks :D
1 DOOMman007 2018-03-17
I just meant in general about the content, welcome BTW.
1 I_Palm_Trees_AMA 2018-03-17
Cute
10 Floridian_Giant 2018-03-17
There’s a lot of inconsistencies with this Twitter Voicemail stuff and I believe it’s an elaborate hoax.
I think he deactivated his Twitter account because he didn’t think it would explode like this, go viral, and have a bunch of people pouring in other information to add in on it. That’s just my 2 cents though.
6 Arszilla 2018-03-17
We spoke about this below in the comments. We are aware of these but still, something is happening.
Regarding (4). A lot of people throughout the states got this. Even some redditors. So the voicemail is legit if you ask me.
3 neverwinterblight 2018-03-17
so far the only other source is a false cicada account unless I'm missing something? So how do we know anything is actually "happening"? I'm skeptical about anyone saying they received a call like this. Trolls are abundant when things like this come up.
2 Arszilla 2018-03-17
There were a lot of tweets under Ty's but before anything could be done when we noticed there were credible stuff down there Ty closed/deactivated his twitter.
1 beetsbaby 2018-03-17
Can somebody tell me what cicada is?
3 Floridian_Giant 2018-03-17
Hey so I was playing around with speech selection on my iPhone and I changed the voice to “Samantha(Enhanced)” and slowed the speech down a little. Went to notes and typed out the phonetics and it sounds EXACTLY like the OG voicemail.
2 Arszilla 2018-03-17
Could you provide a video? Maybe all this could be a lie?
2 Floridian_Giant 2018-03-17
Proof
I had to include the text of the message in there because it kept using a foreign accent when I tried doing speak selection and wouldn’t use Samantha(Enhanced)
1 Arszilla 2018-03-17
Sounds famiiar but I remember the original being slower. Way slower.
1 Floridian_Giant 2018-03-17
I just compared them side by side. The original is a little bit faster and they say Foxtrot and all the numbers the EXACT same way. Compare them.
1 Arszilla 2018-03-17
Huh. i remembered it being slower. Maybe thought that was because I was awake and tired at 5 am
1 Floridian_Giant 2018-03-17
Here is the link to the tweet about Stephen Hawking.
1 Arszilla 2018-03-17
Thanks. Will update my post in a bit. 2 hours approx
1 reverendbojangles 2018-03-17
but the date this was posted was 2 days after his death. So far I have not seen any evidence that this claim was made before his death. Unless the morse code message they received this from was included in the VM and I missed it.
1 congratsonyournap 2018-03-17
“But still, something is happening.”
Wow you really want this
1 Detectivish 2018-03-17
Hi sorry, I'm way late to your party & as we both know, today is indeed 4/18/18 lol. I just wanted to ask you one thing about your above comment. You stated, "So the voicemail is legit." I just wanted to ask you if you could expand on what exactly "legit" means to you? Do you mean that it's legitimately a voicemail from the bb recorder?
1 Floridian_Giant 2018-03-17
I still think it’s a hoax but it’s fun to watch nonetheless lol If I wanted people to believe this, I would *67 random numbers and leave that voicemail, just because.
1 mermaidsarerealyo 2018-03-17
I've been lurking in this thread for ages and the thing that makes the most sense to me is that the voicemail is actually a message from the ship that is supposedly searching for the plane that went missing for three days recently. Apparently the last day of the search time is April 17th and with the date in the codes being april 18th just seems way too coincidental to not have anything to do with the search.
1 Floridian_Giant 2018-03-17
They turned off their tracking system to revisit two points of interest and didn’t want to give false hope to family members that were keeping track of them. But that was in the beginning of February. They still haven’t found anything.
EDIT: Link to article
10 remington_smooth 2018-03-17
I had a dream awhile ago, like I think 2004, where I was told by a ghost that San Francisco would be destroyed in 2018. The particular date given to me, I think, was 4-18-2018. But don’t hold me to that it was like 12 years ago. But that’s the reason I’m even posting this, because if something is going to go down on 4-18-2018 and it involves the destruction of San Francisco, I would feel really weird about it.
In the dream, I was in an old house that used to belong to my grandmother. The house was from the 1800’s and as a kid I was sure it was haunted, but that is just my impression as a kid. As an adult I know it’s just a rambling old house. I still dream about it frequently as a haunted place though...especially when under stress.
Anyway, so I’m in this house and I was completely terrified. But I actually used to have a lot of night terrors, and after awhile of having my sleep messed up every night, I got kind of pissed off so when it did happen, I used to try to “confront” whatever was causing the terror in my dream. This was hilarious for my girlfriend because it often involved me getting up and flicking the lights on looking for something, then waking up and not remembering wtf I was doing. One time I had actually woke up to find I had pulled the twin mattress I was sleeping on up and barricaded it against the window. Fun times.
So in this particular dream, it started out as just a haunted house kind of dream, the kind where I couldn’t see the entity, but knew it was there, and so I confronted the entity in my dream. I started to ask it who it was, to show itself, and why it was there, etc.
The reason why I remember this, 12 years later, is because of the details. In the dream, the entity told me that he was a guy named Rick Stimson, who just died recently, and found out somehow that there was going to be something terrible that will happen and San Francisco was going to be destroyed, maybe by a meteor. He said that in life he worked as an emergency responder and saw horrible things in war, and was upset by this impending catastrophe and so was kind of breaking the rules to tell someone.
I pressed him on when exactly it was going to happen, because he seemed a little vague on that point, and I think I even called him out on the vagueness, so he replied something like “time doesn’t have any meaning where I am now, it’s hard to give you a date that would make sense”. I pressed further and he gave me April 18th, 2018.
So the next day when I woke up I remembered most of the details of the dream and decided to look up the details on the Internet. I thought it was kind of funny that his name was so specific. I don’t know anyone named Rick Stimson. I thought it hilarious that that’s the name my mind came up with for a ghost.
Weirdly though, In the first few search results an obit came up for a Richard “Rick” Stimson in West Chester New York, Vietnam Vet and Former Fire Fighter or something. You can still see that obit today if you look.
Anyway, just thought it was relevant. Probably nothing, and sorry for the length.
1 lifeinthefastlane999 2018-03-17
Your story is more interesting than whatever is going on with the voicemails imho
1 Andretti17 2018-03-17
Agreed!
1 -spartacus- 2018-03-17
That is actually accurate to say "time has no meaning where I am now". It is also interesting it took place in a dream where it is much easier to communicate because there is less barriers but also makes harder for the person with the dream to make sense of things because there's less perfect translation between sides of the veil.
1 trainstation98 2018-03-17
If this ends up being true I will eat my sock
1 ChinaXpat 2018-03-17
Just look at Nostradamus' predictions for 2018.
Sounds like Rick Stimson passed you a message from the other side, probably knowing you would post about it here.
1 Arszilla 2018-03-17
I will be sure to add this to the story. Quite interesting
1 lilybear032 2018-03-17
why do I have so much de ja vu reading this..?
1 remington_smooth 2018-03-17
I don't know, did I mention it in another comment somewhere? I don't think I have mentioned this specific dream, but I have talked about some of the night terrors in other comments. Maybe you saw one of those?
Or maybe you had a similar dream. Just from talking to people on here and elsewhere, it seems to me that night terrors seem to conform to a kind of formula like this. You are in a kind of semi-lucid state and see things and you have just enough motivation to get up and move the covers around or flick on the light. Then since you had that movement and often wake up not in bed, you retain some fragmented memories of the event. Then your brain tries to find meaning in the fragments.
I came across a post one day where someone was talking about her night terrors involving a floating old woman and also one involving something cartoony and non-sensical. I don't remember the details of her post now but some of the details were identical to a couple night terrors I remember having.
That is not to say I put much stock in night terrors as anything more than a waking dream. It could be something more, but if it is, it's kind of a lousy vehicle for prediction in my opinion.
1 pink_bowie 2018-03-17
idk if this is related or not, but: http://www.bbc.com/portuguese/internacional/2016/05/160506_san_andres_terremoto_if (sorry, PT-BR, but google translator can help)
10 guttpa18ar 2018-03-17
Hey so I don't know if everyone has moved passed the rabbit part, but I just wanted to mention that with the talk of the lunar rabbits and one of the youtube videos depicting the moon and a rabbit from the children's book "Goodnight Moon" that East Asian cultures, specifically Chinese and Japanese have folklore about the shape of a Rabbit on the moon. There are two versions of the Chinese folklore, one being that the rabbit is the companion to a goddess and is pounding the elixir of life for her and the other is that the rabbit is pounding medicine for mortals. I don't know if this important, but it may be something.
1 Knom305 2018-03-17
There was a QR code that led to a website of last words from pilots of a plane crash. The last words from MH370's pilot was "Good Night."
1 -spartacus- 2018-03-17
I remember this!
1 J-ToThe-R-O-C 2018-03-17
yes, thank you! You are the only other person I've seen make this connection! Kaguya-hime, a princess from the moon, was often mistaken for a lunar rabbit due to the bamboo shoots she wore appearing like rabbit ears
9 BrazenBull 2018-03-17
https://en.wikipedia.org/wiki/Cicada_3301
6 Arszilla 2018-03-17
I know who are Cicada3301.
But maybe they are trying to something different this year? Some of the info shared by Cicada370 seems legit, like thermal camera.
6 YouSaidWut 2018-03-17
I did 5 minutes of research so this could be nothing but:
http://1711141131131.xyz/
Seems to be related slightly
2 Arszilla 2018-03-17
We are aware of that site. Not sure if I did link it among the 20000 letters I typed.
1 Im_naK 2018-03-17
It could easily be an altered image of a plane taken from Google, right?
9 epikninja123 2018-03-17
Guys it’s worthy to point out that the dead body in the Water Heater video is the mummified body of John Torrington, a member of the doomed Franklin Expedition to cross the Northwest Passage. He died fairly early in the voyage, on January 1st, 1846 when he was 20. I don’t know what connection this has to the rest of the story, but if I had to take some sort of guess it would be that both this expedition and the Malaysian Airlines flight were both lost.
4 duffmanhb 2018-03-17
Doesn’t the HL universe involve a ship getting teleported? I think it’s the ARG for Portal.
1 epikninja123 2018-03-17
That’s possible, it was one of the theories I had for a bit.
1 ontopofoldoaky 2018-03-17
or half life 3, sionce valve said recently that they are going to make games again.
1 chasethenoise 2018-03-17
come now, we're discussing actual possibilities, like aliens or lizard people.
1 JimmyJoJR 2018-03-17
There's a really obscure book talking about these giant humanoids in the arctic that killed the crew of the Franklin Expedition. Don't know if it's relevant though
1 Detectivish 2018-03-17
Do you mean Frozen in Time?
1 TheSovereign2181 2018-03-17
Also the background music is from that story where a guy accidently heard a weird transmission.
9 Ballsdeepinreality 2018-03-17
I'm going to throw out a theory, and I really hope to be able to come back and elaborate on this.
What if this is some escaped, or even "naturally" occurring intelligence that is just trying to find a way to communicate to us through these digital mediums?
Because this is weird as shit, and it seems really elaborate for a LARP.
15 Varaetia 2018-03-17
I like where you're going with this, I actually had a similar thought.
I am of the mindset that a lot of "extraterrestrial" life is FAR more complicated than we can even begin to comprehend. Everybody can visualize the classic "greys", and the more modern idea of reptilians, but I think that life exists on a level that we cannot physically see--not completely, anyways.
I believe that a number of UFO sightings are, indeed, spacecraft--but I also believe that a number of them are literal living things. I've actually had a personal experience like this, where I saw a light in a tree that seemed to know it was being watched, and it moved back and forth behind the leaves as I turned my head to watch it more.
Where these so-called "intelligences" originate from doesn't even totally matter to me; they could be from the moon, or from a dimension on our own Earth that we cannot normally see. They could always be existing right beside us, just like the flora and fauna we CAN see.
Where I'm going with all of this is, just like you said: They could be intelligent and capable of communication on a human level, but it could be extremely complicated for them to do so by conventional means--or even well-known esoteric means! I've heard many tales of other lifeforms communicating with humans via ESP or dreams, and I believe those stories.
And so, going off of your idea a bit here, I could absolutely see some kind of life form existing that cannot speak, not vocally or even with ESP necessarily, but a life form that IS capable of higher thinking, and IS capable of communication on a human level, and therefore has to do it in really weird complicated ways that barely make sense to us.
It could be that there IS life on the moon, and it IS among us here on Earth. And maybe it can only communicate digitally, through radio waves or even through LIGHT. After all, us humans have discovered some pretty bizarre ways of communication outside of speaking and writing. I'm currently conveying my ideas to you via digital input on a computer, and my words are being illuminated to you on bright lights.
I could go on--just saying, I totally hear ya :)
1 Pidjesus 2018-03-17
ET could literally be anything... hell there's a chance that it's invisible, why not?
1 SPAMRAAM_ 2018-03-17
That would explain the bizarre array of different codes and languages. It’s easy to just assume it’s some larper trying to make everything look edgy and mysterious but through your theory it would be an intelligence familiar with all our different methods of communication trying them all out to see what sticks.
1 Ballsdeepinreality 2018-03-17
You've elaborated for me, lol.
To expand, it could also be an AI or even a naturally developing AI.
1 crestind 2018-03-17
Those glowing light type UFOs supposedly have some sort of weird connection to consciousness, if that makes any sense. The CIA is very interesting in consciousness... I think dreaming has some great significance we are not really aware of, it's not the random neurons firing like we think.
Look into Kozyrev Mirrors.
1 nonpalo 2018-03-17
or maybe aliens are underwater and can't breathe air and are limited in what they can do and that was them trying to communicate with us
atlantis
12 hxczach13 2018-03-17
Oh man, that's it, I'm convinced, Steven Hawking has uploaded his consciousness to the internet.
1 Ballsdeepinreality 2018-03-17
I mean, sure, but not so much.
1 ChinaXpat 2018-03-17
Hawking was a black hat
3 samjaam 2018-03-17
Ou i like your theory , even if larp or arg I'm hooked lol
1 bukvich 2018-03-17
It's Tyler.
(just kidding I think it's a goof; also I think it is a Really Great Goof.)
8 ayyyee9 2018-03-17
I forget where, but I read something pertaining to “pour liquid nitrogen on them” or “rub them with liquid nitrogen”
It may not be related to this, but maybe that could be our weapon against them? If Nasa is demanding an April 16th deadline for the launch, then we might be informed or warned on the 17th. Are there any events or speakings around the world planned on that day?
Edit: Also another theory. Remember the rabbids game on Wii, where you destroy rabbits that come to earth or something? What if this game is related to this mystery, in terms of them preparing us for whats to come?
7 King0fThoseWhoKnow 2018-03-17
Someone in one of the threads tracked it somehow to some random pc game of some sort, anybody know more about that?
1 pacobjerez 2018-03-17
I saw a video of the pc game. It was very weird and 8-bit I think. At about 30 seconds into the video the audio is just the sounds of planes crashing.
2 King0fThoseWhoKnow 2018-03-17
Yeah it looked like some shitty NES emulator 90s kinda left right up down with a ball jumping with some red kinda futuristic background and thats it
Edit: name of the game was ".clos" or something like that. Whoever can find it maybe OP can include it
7 Varaetia 2018-03-17
I feel that I've missed something--apologies if this has already been explained in the main post.
I do understand how everyone is viewing the Twitter as an ARG now. That makes sense to me because of the Cicada stuff. But what about the original voicemail and the connection to the flight? Did anybody ever make a 100% confirmed connection between the weird twitter account and that guy's experience? Did we ever figure out who he is, or what happened with him, or if he has something to do with the ARG?
Again, sorry--I feel like this has been mentioned. I just think I missed it because I don't totally understand right now.
EDIT: I was curious because maybe the Twitter is hopping onto the weird situation as part of the ARG thing. But maybe that voicemail is some weird unexplained signal from a plane. Who knows!!
6 klypspryngyr 2018-03-17
I’m in the same boat as you. I lost the connection between hijj/cicada and the voicemail. Or rather, I never made the connection between the two. I’m still curious about the guy, his account, and the original voicemail posts!
5 PradaSentinels 2018-03-17
I am totally agree with connection between voicemail, the flight, the guy's experince and the twitter account. Still following the update though.
2 aeronatics 2018-03-17
Exactly what I’m wondering!
7 Pidjesus 2018-03-17
This is all being hijacked to make it look like a hoax now
7 thelambhamster 2018-03-17
I feel like thats true. It seems like we were close to finding out something so they had to redirect it. Who was the man outside Ty's house? Where is Ty now? Why would they use an ACTUAL tragedy for an Arg? Things aint adding up...
4 Varaetia 2018-03-17
Yeah, not a bit. I know extremely little about LARPs, ARGs and all that sort of thing, but I'm under the impression that they're usually very vague, cerebral, linguistic/puzzle related things, and they're usually pretty upfront about what they are.
This situation is very different. I wish I knew where Ty went. I hope he's ok...I hope he's alive honestly. Because like you said, ARGs and stuff don't seem to use real tragedies for their games. Not only is this seemingly related to a real tragedy, but it's also linked to a very real and very strange situation that's NOT related to any kind of game.
What if that voicemail had nothing to do with flight 370??? What if it was a true, honest-to-goodness warning being sent out from somewhere? What was it telling us? Who (or what) is behind it? The answer, in my opinion, is certainly not "just more larpers"
1 cassious64 2018-03-17
This is definitely what I'm thinking. The hjj/cicada thing doesn't seem directly related to the voicemail
2 Helicbd112 2018-03-17
It's been hijacked for some ARG or promotion you mean.
1 Tornadic44 2018-03-17
You bring up a really good point. Maybe those extra puzzles/clues/trolls were just trying to distract people from the main thing?
7 Leoriooo 2018-03-17
I don’t see how all of this stuff ties together. The only solid thing we had was the voicemail- and then suddenly it seemed twitter accounts took advantage of the situation.
Even the ties to flight 370 are so vague. It’s just because one person said that a solar flare made the black box recording show up on some random dudes phone.
I would love if someone could disprove me as it is more interesting if the voicemail is connected to the flight & tweets, but I think everything went waaaay off tangent
6 Mynameisaw 2018-03-17
I think MH370 is a very small part of this.
So what I can gather is that we have one person who's claimed to find MH370 on Google Maps with bullet holes in it.
Then multiple people have claimed to receive an SOS message through their VM that claims something about "none humans," assumption suggests aliens.
Now posting this all on twitter is where it all goes tits up, because I think there's also an element of trolling and shit, apparently 4chan's involved? So there you go, that's probably lead to people being doxed, hence a lot of weird Latin texts and stuff.
But I don't think that's where the theory ends.
/u/eikogray1111's post goes in to some stuff, like how Elon Musk apparently spoke about the failed SpaceX launch and how they apparently found the wreckage riddled with holes (See, MH370 apparently being found with holes).
As well he touches on the slightly weird urgency from NASA about the upcoming SpaceX launch on the 16th April, and how it's imperative for it to go ahead, apparently because Astronauts need to go that day and no earlier (Why would they launch earlier than scheduled, and why would this even need mentioning?)
And to top it off, this all kicked off on Monday/Tuesday, right when Trump supposed America might create a space army for fighting in Space.
To me it's all a lot of coincidence, probably some trolling and stuff. But the idea that we may, in the next couple of months have irrefutable proof of Aliens is pretty fucking cool.
Though the concept of a space war with Aliens is fucking horrifying.
2 Leoriooo 2018-03-17
Yes everything after the Twitter/4chan involvement seems like larp/arg. But I can’t help but feel attracted to the original mystery for the same reason you stated: potentially alien life is involved.
While it is a tragedy flight MH370 disappeared, the amount of time and resources they have put into finding it points to the fact that higher powers are interested in it.
Totally random thought, but I wonder if the recent buzz around Antarctica a few months ago led up to any of this.
1 higusmaximus 2018-03-17
I missed the recent buzz about Antarctica, what was it about?
1 Leoriooo 2018-03-17
Search Antarctica in only r/conspiracy, the first 4 Threads are very interesting.
1 NOcomedy 2018-03-17
World Wide Web has 90-99% more information on every topic. Use www.
1 eikogray1111 2018-03-17
Yea, I see how the things I mentioned could seem far reaching. I could be completely wrong. I have just been digging through articles and the way I described it is how it was written that they expressed urgency on this launch. I thought it was odd that it specifically said the launch could not happen before the 16th, but had to be done as soon as possible on or after that date. None of these things were directly related to the MH370 tweets, I just wanted to see what was going on with current space affairs and that is what I found. I still encourage everyone to look at the CIA gateway document, its about 29 pages long. Whether this specific incident is a hoax or not, the things that I referenced are not.
1 SandMonsterSays 2018-03-17
I for one am going to be super mad if something happens around the 18th of April. I already bought my tickets to opening night of Avengers infinity war and that's the only freaken space war I feel like being involved in.
1 tsniagasaxor 2018-03-17
i think the entire Elon Musk and NASA deal is weird all in itself, but, would these solar flares spark up a charge in the FDR thats been dead for 4 years? The flight data recorder and cockpit recorder can only be powered for up to 30 days was said to have stopped working in April of 2014 while they were still searching for MH370.
3 Arszilla 2018-03-17
The black box can’t send messages. It only beeps. So this voicemail has to be something else.
Look up how a blackbox works if you don’t believe me. Those boxes can beep for 1 month till their battery dies. They beep so sonars etc find them if the plane crashes in water etc.
4 Leoriooo 2018-03-17
Exactly- so that gets rid of all ties to flight 370.
I still want to believe it was a real distress signal that just got sent wherever it could before whoever sent it disappeared/died but I don’t think it has any connection to the flight or any arg on Twitter.
By the way thanks for updating the thread so diligently, I have definitely enjoyed reading it regardless of my belief on what is going on
3 Arszilla 2018-03-17
Well not really. But the source of the voicemail is unknown. Not even sure if Solar Flares did such a thing (even though they can)
No problem, I enjoyed making my first megathread. Sorry I got a bit lazy towards the last edits as it was getting a lot to add/remove and I just wanted to place them asap
1 sophung 2018-03-17
Also, why would a SOS distress signal be codified, and in Phonetic Code instead of maybe Morse Code? And why would a message from a black box of a crashing plane be spoken by this very Siri-sounding deadpan voice calmly spelling out a code instead of, you know, a screaming pilot who is freaking out because his plane is in serious trouble, or maybe a crew member speaking, like a normal person, about something suspicious in the plane?
1 Detectivish 2018-03-17
..but you're assuming that the alleged distress call was sent from a plane that was about to crash, when it's been heavily implied (imo) that, in fact, there was no crash & something altogether different happened to the flight.
2 samjaam 2018-03-17
We mussst go backkk
7 ayyyee9 2018-03-17
2 days before 420, that blows man.
1 Impetus37 2018-03-17
Its march, not april..
1 ayyyee9 2018-03-17
The supposed happen date is April 18th. April 20th is Weed day. This event is a few days before 4/20.
1 Impetus37 2018-03-17
Oh okay, what a coincidence you made that comment 2 days before 20 march
1 NOcomedy 2018-03-17
So you can get high AF with Pleadians!!! What better way to celebrate 420 this year?
1 ayyyee9 2018-03-17
Hey maaan, do you have any snacks?
We have some garble flarble left
Its okay, I have water.
1 NOcomedy 2018-03-17
Pleadian pizza is the shit. Wait and see...Italians...pffffff ...plus they have unfluoridated water...oh and, you will not be able to pass fluoride past the chemical security squadron (css) upon entrance.
1 ayyyee9 2018-03-17
We taught Italians everything they know
1 BongHits4Christ 2018-03-17
When i first saw this thing today, thats the first thing i though lol. Glad to see someone else has their priorities in line :)
7 jjb8712 2018-03-17
The voicemail said “nine”, which is not correct in aviation/military terms as it is too close to the phonetic “five”.
1 MamaeBR 2018-03-17
nine = Niner
1 jjb8712 2018-03-17
Say “nine” and then say “niner” And you’ll see what I mean. Nine and five can sound too alike.
6 jpGrind 2018-03-17
larp, arg - who knows. interesting as fuck either way. saving some screen shots.
9 morceau 2018-03-17
I think it’s an ARG for sure. I’ve participated in them in the past and it definitely has the correct feel and pacing for it to be an ARG.
6 TwistedBeacon 2018-03-17
can't be cicada. their grammar is bad, no PGP signature, and they're behaving very unprofessionally on their twitter right now.
1 Arszilla 2018-03-17
Fuck the grammar
There is no PGP
But I’ll leep the cicada warning till they post the first puzzle tomorrow.
6 mrsdoubleu 2018-03-17
So it seems like this is just an elaborate ARG? I'm too dumb for those so I'm just going to file this under hoax
6 LordMandrake_ 2018-03-17
This is the most thorough post I've seen on this board in a long fucking time. I tip my fadora to you. Mods should sticky this.
I had no idea about how intricate this subject was before reading your post and I thank you for bringing this to my attention.
6 Almox 2018-03-17
Does anyone else think its interesting that all the "leads" in this investigation seem to be easily found somewhere online? Surely if this was something not meant for the public everything would not be found with a simple google search.
5 Varaetia 2018-03-17
I JUST started following this story, I haven't caught up on everything but I wanted to share a screenshot--within the past 15ish minutes, that account that keeps disappearing and reappearing on Twitter posted this: https://imgur.com/a/7KgCD
It is 3.30 in my state, if it makes any difference
Interesting stuff for sure!!
5 AlwaysDankrupt 2018-03-17
it's probably already been said but the name of the account "dimasryp rea emoh" is an anagram for "pyramids are home"
1 haveabananur 2018-03-17
lunar is home would make sense - it is a secretly held belief that the moon was in all reality the previous incarnate of our Earth many eras ago- intelligent life supporting and the home of our ancestors. https://m.youtube.com/watch?t=5743s&v=GbWMw249xY8
3 Arszilla 2018-03-17
We are analyzing the tweets, and getting stuff. We got some mail addresses. I am writing the updates as my buddies from the thread decipher info
5 Varaetia 2018-03-17
Nice! I'm anxious to see how this develops, I'll definitely be keeping up with everything
Also, for what it's worth, the whole "lunar rabbits" thing reminded me of a VERY interesting story from a friend, kinda gives me shivers if I really think about it
Long story short, we live near a pretty well known military base (not area 51) and my friend's ex-girlfriend had family that worked there. One day she was with her dad on base for something--there was some legitimate reason she was allowed on base with him, I think it was something to do with school or maybe a doctors appointment? Or maybe he had to stop by the base for something briefly, and brought her in with him--I can't remember for sure.
Anyways, they were on an elevator, getting ready to leave the base. Apparently that elevator stopped to let someone in from a floor that normally the girl (or any other civilian) would not have been allowed to see. Just a totally classified area of the base I guess. And when the doors opened to let that other person inside, she saw, bizarre as it sounds, a giant rabbit. Not like 20 feet tall or anything, but like...believably giant. She told my friend it looked like one of those fuzzy Angola rabbits, and it was maybe the size of a Great Dane, or slightly smaller. It had a couple military officials handling it.
She literally only saw it for a moment or two as the door opened, the person walk in, and the door closed--but there was no mistaking it. Honestly, that's so fucking strange that I truly do believe it happened. Why make up something that oddly specific?
Anyways, just wanted to share, because I'm still catching up with all of the hijj370 tweets, but I've seen a couple about those lunar rabbits, and I couldn't help but make a connection. Maybe it means something???
2 Arszilla 2018-03-17
Maybe. May I ask where was this? Like state/district etc?
4 Varaetia 2018-03-17
Hopefully the feds don't show up at my door for this (LOL), but we are in very close proximity to Wright Patterson AFB, in Dayton Ohio. I personally live about 10, 15 minutes or so down the highway from it.
My own family has had experiences with them too--in the late 1960s (66 or 67 I believe) my grandma, who lived on a big ranch-type property in our town at the time, had a UFO experience. One day pulling into her driveway, her car started acting strange, and she saw lights flashing in her back yard, which was an apple orchard. She ran to the back and saw the classic saucer-styled object, with rings of multicolored lights flashing around it. She watched it for a couple moments, and then it zig-zagged away, literally burning off the tops of all her trees.
She was in the Dayton Daily News for it (I have the article buried in my basement somewhere) and within a week she had Project Blue Book guys and other military officials knocking on her door, telling her to shut up about it. They told her that if anyone else from the media wanted an interview, she was to tell them she didn't want to talk about it.
1 ChaozVenom 2018-03-17
Did the feds show up?
1 jjjjjjjjjjjjjjjj 2018-03-17
Look up North Korean giant rabbits. They did manage to breed them and sold them to the previous Kim. Not sure if it's related.
1 BussinFatLoads 2018-03-17
It’s weird that this was the first location that came to mind for me.
1 adeptusminor 2018-03-17
I want to see that rabbit! Sounds amazing...and fluffy.
2 noflyman 2018-03-17
Hoax is sent until its a fact....could this be to the affect of a cover up of the plane until its uncovered?
1 TheWiredWorld 2018-03-17
Good idea.
1 UnlearnedTruth 2018-03-17
The account name looks like scrambled letters spelling PYRAMIDS ARE HOME.
5 PradaSentinels 2018-03-17
So, this is a Reality game afterall and help upcoming Cicada events? based on this twitter account
5 Bluezim 2018-03-17
The Cicada3311 Twitter posted this 14 minutes ago https://twitter.com/Cicada3311/status/975117183843004416?s=20
ARG confirmed
1 Guyote_ 2018-03-17
What did it say?
0 The_Jizzrobot 2018-03-17
It's Cicada 3301, not 3311. That account was made this month.
Edit: Also account deleted / renamed / whatever.
1 Bluezim 2018-03-17
Cicada 3301 was the last round of this puzzle. They are using 3311 now to differentiate.
5 dnesarumane 2018-03-17
I just can’t really get behind this being a real Cicada puzzle. All of the previous puzzles have been hard to solve, and with no official word on it either.
I believe the accounts that messaged the OP and now the Cicada acc were trolls messing with OP and taking advantage of the voicemail’s contents.
As for the voicemail I have no idea if it’s real or not. The only person who knows that is Ty himself.
2 Arszilla 2018-03-17
Again trolls are normal, they would appear.
The issue is this “Cicada” did not provide PGP. Thats the main issue. Maybe essy puzzles were there to get people involved and get in the thing these people claim its a “group work”
1 dnesarumane 2018-03-17
No that’s exactly why I don’t believe this is really a Cicada puzzle, I’m almost 99% sure this is just some bored kids who wanted to hop onto the bandwagon with the voicemail itself.
The only real creepy thing here is the voicemail which seems real but there were a lot of inconsistencies between it and a real SOS message according to a veteran family member of mine.
2 crop_circlejerk 2018-03-17
This ty guy doesn't seem like he wanted the attention or would go to such great lengths and fake the whole thing but who really knows
5 Pidjesus 2018-03-17
We'll never know the truth about the MIB/First voicemail, I say we separate all info from the 'fake' twitter accounts and what Ty has posted.
6 Arszilla 2018-03-17
So another post? Hmm, that would require a whole lot more research/skimming. And with Ty deactviating his account, its way harder
7 Kyaian 2018-03-17
Ah, harder, but it will help narrow down the confusion. Really this guy who claimed to be Cicada, distracted us from the original source, Ty's predicament. Before he deleted his account, looking through his stuff, his account was honest to god something you would skim over, maybe follow for a few funny memes he posted. Obviously there is a point of a drop off from the source material, separating were reality becomes 'fake' could be useful and help figure out what happened to Ty.
1 Arszilla 2018-03-17
He deactivated the account, did not delete it. Ty is fine, he just couldn't handle this so he deactivated the account. /u/lmgbylmg is his buddy.
1 Kyaian 2018-03-17
Ah gotcha, welp I guess it's a waiting game then?
1 Arszilla 2018-03-17
Probably. We gotta see if these guys come back in 14-15 hours and maybe the real Cicada comes to clarify this?
5 Chimi_Ganja 2018-03-17
So this is just an arg cicada puzzle?
3 Arszilla 2018-03-17
No proof of them being the real cicada though
2 Chimi_Ganja 2018-03-17
Ok, also i feel like i missed how the original tweet is related to the cicada account, did i miss something or is there no hard link between them
2 Arszilla 2018-03-17
Original Cicada provides PGP when they start a puzzle etc.
1 Chimi_Ganja 2018-03-17
Ok makes sense thanks
5 BayesianProtoss 2018-03-17
Bioinformatician here. I looked a little more into the DNA sequences.
First all, its from a mouse specific microarray, which off the bat seems a little sketchy (in the sense that it is not sketchy at all). Basically, it's a little chip that contains a bunch of mouse specific DNA sequences that you can use to tell how much of a certain strand of DNA you have. No way this would be used for an unidentified creature.
However, you can look up the DNA sequences using a technique called BLAST, which lets you search for documented other sequences to see what your sequence is for.
I used BLAST (on the first sequence): ATCATCGTAGCTGGTCAGTGTATCCTTTTTTTTTATCATCGTAGCTGGTCAGTGTATCC.
Nothing came up, which means that it hasn't been documented in mice. That's actually a little strange.
The other thing that bothered me about this is that the technology is extremely old. Microarrays aren't commonly used to do this sort of stuff (identify unknown transcripts).
I'm not sure what to think, it is interesting it hasn't been documented before, but I think all of the other circumstances make me disinterested in pursuing this more.
1 Arszilla 2018-03-17
Well there were 2 “creatures” that were recorded; in the thread. Could it be them? As you said it aint mice. These look like sea creatures.
1 congratsonyournap 2018-03-17
Wdym its not mice and it could be sea creatures? I am very, very lost
1 Po1s0nShad0w 2018-03-17
/ATCATCGTAGCTGGTCAGTGTATCCTTTTTTTTTATCATCGTAGCTGGTCAGTGTATCC. I knew my biology would someday make me understand
4 Carlos_Dangers_wang 2018-03-17
Can someone please give me a really short version re: what the topic here is so I get what this is about?
For some reason the initial audio won't play for me. I tried yesterday several times.
edit: thank you
9 Arszilla 2018-03-17
Basically a solar flare perhaps fucked with comms. People have been getting a NATO Phonetic Alphabet coded message saying
People linked it to MH370; the plane that disappeared 4 years ago with 239 on board.
A twitter account with the name Hijj370 (Later on as Cicada370) was identified to be a source of messages. Account has disappeared twice now (Changed names previously). Account has been posting stuff regarding 'aliens'/'extra terrestrial beings' being involved regarding MH370. Pictures, statements etc.
5 psyderr 2018-03-17
Doesn’t make much sense. Hard to see the connections
4 greatrater 2018-03-17
A girl gets a military coded voicemail that translates to HELP SOS DANGER THEY AREN'T HUMAN and gives coordinates. The coordinates are close to where the Malaysia missing plane was last seen. People are pouring in with evidence suggesting that the call was linked to it's disappearance and are providing theories and evidence as to why it went missing.
4 Nigel-Tufnel- 2018-03-17
Strangely this exact story was in the front page yesterday with a similar title.
https://www.reddit.com/r/conspiracy/comments/84x0n4/not_political_twitter_user_receives_creepy
7 Arszilla 2018-03-17
That OP posted after I posted. I have combined both posts (https://www.reddit.com/r/conspiracy/comments/84uon2/a_major_technology_newssite_in_turkey_has/ and https://www.reddit.com/r/conspiracy/comments/84x0n4/not_political_twitter_user_receives_creepy/) for the sake of a megathread.
I used [NOT POLITICAL] as there are no signs of politics right now, aside the fact that the Malaysian government's reward money.
4 RadLatinoHeat 2018-03-17
Don't know if anyone did this already or if it matters, but on the reversed video that was reversed again by the redditor that doesn't want to get too involved that OP mentions, the NATO alphabet that's spouted out fast comes out to "lunar is home with space triangles are built with haste."
1 jimster010205 2018-03-17
The directly correlates with the moon bitby country bluff it says Home at the end dang thats weird
4 Klawsterfobia 2018-03-17
I belong to a facebook group called "Creepy ones" and someone posted this https://www.facebook.com/photo.php?fbid=10155670869668051&set=gm.1200507850086668&type=3&theater
(im not sure if you can see it since its a private group. Anways. the post basically said his girlfriend got a weird text message that read "WARNING non threatening terrestrial threat signed at 18 ° 51S 41 ° 56'W" It seemed like it could potentially be related to this? so i thought id post it.
4 xFr0sted 2018-03-17
Please share a Screenshot
2 Arszilla 2018-03-17
Can you share a screenshot and google maps result of the coordinates?
1 klypspryngyr 2018-03-17
I don’t think this is anything tbh. It’s a town on a river. In Brazil. Can update with image link soon
Edit: hopefully this link works https://imgur.com/a/r0w2a
1 jubbbx 2018-03-17
I searched for something extraordinary that could have happened in Governador Valadares, but I came with nothing, only a plane forced to land on Doce river em 2011 (everyone survived)
1 ptoli 2018-03-17
Found this, though
https://www.youtube.com/watch?v=LkzUkI_gcC4
1 jubbbx 2018-03-17
This video was used in another moment before. It was been proved that isn't a brazillian video. Link (in portuguese) about this situation http://aconteceunovale.com.br/portal/?p=100881 (anyway, I wish to know what this light in sky was)
1 diegohmartinez 2018-03-17
The Mariana disaster the happened in Brazil affected the rio doce, the coordinates is too near rio doce, something relative perhaps ?
The morse codes with photocopied notes have some brazil notes too, but not related.
0 MamaeBR 2018-03-17
WTF Governador valadares is a place in Minas Gerais - Brazil with no relevance.
1 klypspryngyr 2018-03-17
The only SMALL significance I could guess is the link to the Air France Flight 447 incident. (Scheduled to fly from Brazil to Paris, France). But that’s grasping VERY FAR for straws here. This is literally nothing. There is no relevance.
2 MamaeBR 2018-03-17
But in the AFR447 acident we in Brazil stand for the theory of the ice in tube of pitot. Airbus is a fully automated system and the wrong information could lead a to acident.
1 klypspryngyr 2018-03-17
I agree. That’s why I say the relevance is too far to link together.
2 dantxx 2018-03-17
actually that region is fully related to ufos.
Governador Valadares, Varginha, Serra
Those places in brazil had been HUGE cases of UFO.
its been a long time since i was in brazil but i can confirm that
1 MamaeBR 2018-03-17
I know about Varginha but it's 629 km of distance of Gov. Valadares.
1 muskrat0110 2018-03-17
"Non threatening terrestrial threat" 🤔
4 KayleighEU 2018-03-17
I absolutely do not believe Cicada are behind this. The account posting their information is so...informal..bad spelling and grammar etc
2 TwistedBeacon 2018-03-17
yeah, not professional at all, nothing like how cicada usually is.
2 Arszilla 2018-03-17
And no PGP/opening DMs.
4 smitteh 2018-03-17
literal insanity im reading here
4 Klawsterfobia 2018-03-17
http://imgur.com/X52Czm0
1 klypspryngyr 2018-03-17
We talked about this already, further down in the comments. The location from the coordinates is unrelated
Edit, here’s the link to the parent (works hopefully) But anyway, thanks for posting the screenshot cause now we can look into the number it came from!!
https://www.reddit.com/r/conspiracy/comments/853vyr/comment/dvv5o6a?st=JEW33WCI&sh=1691ab5e
Edit again: saw you were the original poster. We’re still looking into it
4 88Phil 2018-03-17
https://www.channelnewsasia.com/news/asiapacific/malaysia-airlines-final-report-on-missing-mh370-10025954
So, aliens decided to contact this dude coincidentally just a week after this. Talk about convinient aliens
4 Arszilla 2018-03-17
Many others got the same voice recording tbh.
Redditors and people across States.
2 MinxyKittyNoNo 2018-03-17
The original post was from the 13th. Hawkins died on the 14th.
3 NotMySeventhAcct 2018-03-17
Please provide proof that it was posted on the 13th
3 MinxyKittyNoNo 2018-03-17
http://i.imgur.com/EUj2ONQ.jpg
3 NotMySeventhAcct 2018-03-17
Hawking died in the UK very early in the morning on the 14th, which would be the 13th for the US and before this tweet was made
1 MinxyKittyNoNo 2018-03-17
The post was posted at 12:59pm
3 MinxyKittyNoNo 2018-03-17
I would also like to point out that the VM he is listening to said "Friday" which was not the 13th.
Edit. Okay I thought it said Friday but the post I was following was removed again. Can't provide proof. D:
2 Nascarfreak123 2018-03-17
This is the alien warning
https://www.reddit.com/user/skimmer47/comments/8523q4/you_need_to_act_quickly/
1 -spartacus- 2018-03-17
No one is going to post or know where they worked. The message looks coded though, seems to have some tripwires. There is some other stuff there that doesn't make sense.
1 Imadeafire 2018-03-17
Their post/comment history is empty for me.
1 Nascarfreak123 2018-03-17
Ok It discussed the fact that ships are apparently coming to earth in like a few weeks and that we need to prepare. Also why would an account be suspended for investigation?
1 trenchywalker 2018-03-17
Can you repost what was deleted?
3 JordanMckee 2018-03-17
The deleted account cicada370 posted this before it was deleted. The hidden youtube link directs you to a creepy video. Upon further research, I looked at more of the guys videos and found this video where the description mentions "(SOS) April view the moon". ALSO - the title refers to someone called Jack. Another tweet by cicada370 also referred to someone called jack here
4 JordanMckee 2018-03-17
The video about "jack" which refers to April - just like those (possibly fake) twitter accounts - was created just 8 days after the Malaysian Government supposedly payed the US government a sum of money to find the missing plane, of which the deadline is April 18th :/
1 tsniagasaxor 2018-03-17
do you have any links regarding the deal between Malaysia and the US?
1 JordanMckee 2018-03-17
I saw a news article - a few actually - but I'm sure if you google them you'll find some. I think one was actually deleted.
4 beardbrawn 2018-03-17
The random numbers in the title, moon coordinates maybe? Or Coordinates for depicting a point in the sky and not on a globe?
3 JordanMckee 2018-03-17
shit, that's a good idea. any way to check that theory?
3 OnAnOpenF1eld 2018-03-17
Lots of references to the moon. Project BlueBeam perhaps?
2 JordanMckee 2018-03-17
Project BlueBeam? I haven't heard of them. Any info on them that you think would be useful?
5 OnAnOpenF1eld 2018-03-17
It’s kinda tricky to explain but basically America fakes an alien invasion by using holograms in the sky. It also relates to the Moon being a hologram, as well as the Sun being a local body and acts as more of a spotlight then a large ball of gas (yknow flat earth, all that malarkey)
2 JordanMckee 2018-03-17
Cicada370/Hijj370 posted this on their account. Lunar = moon. I think that's more than a coincedince.
1 quxxnolivia 2018-03-17
They’re username is “home aer pyrsamid” I found something about the home aer part but not a lot about the “pyrsamid”
2 Arszilla 2018-03-17
That isnt their last post but one of the last. See towards the INTERESTING STUFF on my post. Some redditor had talked about some of that, related to yours.
1 potatoh8ter 2018-03-17
Tweet goes: ABCDEF G HI 370 jack5
HI 370 jack5
370 possibly referring to MH370
HI jack5 ...hijack?
1 JordanMckee 2018-03-17
Shit, that makes a lot of sense
1 NeverAgainNora 2018-03-17
Probably unrelated, but found another twitter user with more zalgo text talking about the moon rather incoherently. https://twitter.com/Adducere_Pasco
No rabbits on this one, but does talk about sheep. More than likely not related, but I thought I might as well pitch this one into the mix. You never know!
3 CursedCode 2018-03-17
someone received a voicemail around 10 hours ago. this voicemail is in english though so i believe it is fake. https://twitter.com/basspeare/status/974877855636164608 has NATO code at the end of voicemail
edit: another guy has been trying to track hijj370 and has found multiple accounts relating to hijj370. the latest account is following the guy tracking him and has a tweet in morse code that translates to indonesian which translates to stop in english. https://imgur.com/a/3XgLQ i believe this is fake too
2 Arszilla 2018-03-17
That is fake probably, as others recieved it from “Unknown”
Some even had their phone calls interrupted as this “Ky” person on Twitter record it.
1 Erin42 2018-03-17
Another girl posted a message not from an unknown number.
https://mobile.twitter.com/itssamigirl/status/974385913621983233
1 Arszilla 2018-03-17
Do we know what the numbers mean?
1 Erin42 2018-03-17
Coords in Africa is the last theory I read last night.
1 deathlybolt 2018-03-17
The ones in the call from the "Ky" girl lead to the Gulf of Guinea, close to Nigeria. If they are coordinates, they are incomplete though. Still getting the "not human" from the phonetic alphabet.
I got nothing from the ones in the other call. Probably "fake" since it shows a number and not unknown as the other calls
3 Bosh119 2018-03-17
Reading through this makes my head spin. This may sound sadistic but I actually hope it all means something and isn't just some marketing campaign, or prank by someone.
7 Arszilla 2018-03-17
You aren’t alone. I personally hope this is real but not something that may end us.
-2 Bosh119 2018-03-17
Yeah. You don't often see calls from "Unknown", at least in my experience. Makes it seem real.
I can't help but jump to wild conclusions in my head. Perhaps MH370 was taken by aliens but someone has figured out how to communicate back to us.
5 H0n3yb4dg3r69 2018-03-17
I get quite a number of “unknown caller” calls
1 Bosh119 2018-03-17
I've never seen it. Its usually just a really long, random number I don't recognise.
1 throwaway8759376869 2018-03-17
You can prevent that number from showing up with almost every cellphone, caller ID then shows up as unknown caller in the receivers phone.
0 Bosh119 2018-03-17
I thought if you block a number, they couldn't call you?
1 throwaway8759376869 2018-03-17
Not that kind of blocking. Sorry english isnt my native. You can prevent the number from showing. Thats what I meant. I'll edit my comment.
1 lilybear032 2018-03-17
military posts often contact you from an unknown number, for example my prenatal dr on post always calls me back from an "unknown"
3 domthebomb2 2018-03-17
here is a twitter account we found last night that replied to the original tweet. It seemed to be nothing, but we were able to decode the audio file on the video on the account which gave us this image which contains the text "mischief re" which we think means mischief reef. This island is actually called Woody Island, but there are theories that it could be connected to Diego Garcia. There is still undeciphered code on the account.
4 Arszilla 2018-03-17
Adding this to the main post. Thanks!
2 noflyman 2018-03-17
It does resemble woody island off of Google image.
1 Dragon_01000011 2018-03-17
We've deciphered what we believe is the username, but we don't know exactly what it means. Is the text replying to the voicemail still unciphered?
1 domthebomb2 2018-03-17
Yeah we can't figure that out. What do you think the username means?
1 Dragon_01000011 2018-03-17
Here's what we know so far:
1 Dragon_01000011 2018-03-17
d6a7c7617be97c79d7d430463fa6af8f gives us:
6.77617977, 97.43046368
Assuming you are supposed to separate the numbers from the letters, then the letters give us:
dacbecddfaaff
We don't know what to do w/that info. Maybe an onion link?
3 MaestroBelarious 2018-03-17
Aperture Science is from the game Portal isn't it? Portal 3 release 4/18?
2 Arszilla 2018-03-17
?
We didnt even mention Aperture or Portal etc
3 MaestroBelarious 2018-03-17
https://m.imgur.com/KuFNLxl
The text below "Good luck"
6 BigC23 2018-03-17
This comes after Valve announced they are shipping games again. For what its worth, Portal 2 was released April 19th of 2011. The more I see this the more it sounds like we have an ARG on our hands here for Portal.
April 18th is the day the Portal 2 ARG countdown finished. http://valvearg.com/wiki/Investigation_History#April_18
3 MaestroBelarious 2018-03-17
So you're saying... HL3 reConformed?
2 BigC23 2018-03-17
I edited my reply a couple times. The portal 2 ARG sounds pretty similar in a sense to whats going on here. http://valvearg.com/wiki/Investigation_History Heres the whole page
1 MaestroBelarious 2018-03-17
Does look similar. Thx
1 Arszilla 2018-03-17
Oh. I didn't notice that. But I don't believe that website is related. Maybe a coincidence.
1 jussiduende 2018-03-17
Previously canceled Half-Life 2: episode 3 was about missing ship going through multiple realities/dimensions. Also this is supersimiliar to Valves previous ARG. Portal 2 was also released 14.8.
http://valvearg.com/wiki/Investigation_History http://valvearg.com/wiki/Investigation_History#April_18
1 trenchywalker 2018-03-17
If this is an ARG for Portal 3 I'll fucking dance naked at work.
1 multipleklarts 2018-03-17
Let the man dream.
3 xFr0sted 2018-03-17
„He has changed his name to Hijj370 once again and has this in his profile. First thing he tweets after coming back is this. His bio has a braille code
.--../._----...----
When decoded it results with:
add onion“
I guess with add onion he means we should add .onion to something to land on a Tor hidden site (.onion) sites.
5 samjaam 2018-03-17
Who wants to volunteer to do that? Lmao
3 Arszilla 2018-03-17
See the post. There is an onion link there.
1 xFr0sted 2018-03-17
Yeah, it could be that he meaned that, but wasnt that already .onion and didnt had to be addee? Maybe there is a second .onion, maybe not. Could be.
1 ayyyee9 2018-03-17
Maybe the unreadable qr code could have something to do with it? Maybe we arent meant to decipher it the regular way (qr reader)
3 [deleted] 2018-03-17
[deleted]
1 klypspryngyr 2018-03-17
This userlink ain’t working? Everything you click on just gets more shady and frustrating Edit: nevermind , I got it
1 Arszilla 2018-03-17
Looks like he deleted the account. Will edit the post when I am on PC again3 MoonRey1 2018-03-17
This is driving me crazy, I need some answers. It's just very weird. It seems likely that whoever is behind this hijj account is a master troll. The water heater video took a dark turn.
1 AlternativeTentacle 2018-03-17
I’d bet my left but this is deathgrips hyping their new album.
3 hxczach13 2018-03-17
Right before it went down again he said is was for cicada, some quiz.....
3 Arszilla 2018-03-17
Gimme a second I got the posts
https://twitter.com/cicada3311
2 Nascarfreak123 2018-03-17
So it’s offical this is for the cicade puzzles
3 deathfraud 2018-03-17
Account changed to @Cicada3311. Check his pinned tweet. It’s a game.
1 Arszilla 2018-03-17
Edited the post already
1 deathfraud 2018-03-17
thanks bud, this is getting interesting
1 Arszilla 2018-03-17
Officially linked to Cicada now.
1 Griiffiin 2018-03-17
Not officially - no PGP signature. This could still all be a hoax.
1 Arszilla 2018-03-17
I dont think they did PGP lately? Not that I recall from the videos/analysis I watched weeks/months ago.
1 cutiebug 2018-03-17
Cicada3311 seems like bullshit.
3 twclosingtime 2018-03-17
Maybe it's me wanting to believe but this can't be a real Cicada puzzle. I saw previous puzzles and they were nothing like this they wouldn't start from a normal civillian and Cicada himself would definitely not make an official statement. They opened their PUBLIC DMs right now what the hell?
1 Arszilla 2018-03-17
And there is no PGP aswell. Not Cicada if you ask me
They also closed the account when I DM'd and asked/mentioned PGP.
2 twclosingtime 2018-03-17
But if that account is fake then that means that all these leads are fake right? most of these leads were gathered from that account... I really want to believe man I want to see those ships...
1 Arszilla 2018-03-17
Not all I believe. The point where they named themselves Cicada is where it gets “fake”
1 BetweenVegaAndAltair 2018-03-17
i mean, people that work on Cicada puzzles are "normal civilians" - maybe she's part of orchestrating it but also has a normal twitter because she's just a person. (unless you mean, like, ostensibly a normal person - i interpreted it as "why would they send a random person a voicemail to start the puzzle")
3 PradaSentinels 2018-03-17
The account Cicada3311 has been deleted/changed 05.12 AM Indonesian Time.
Waiting for new update.
2 Arszilla 2018-03-17
Probably gone due to I called them out for not having PGP signature in public.
3 lowfisciwri 2018-03-17
I thought it was Cicada 3301, not Cicada 3311?
1 Arszilla 2018-03-17
Its 3311. Probably fake. No PGP and opened DMs unlike previous Cicadas
3 SARAH__LYNN 2018-03-17
Well shit, this will tide me over until the next Petscop episode I suppose.
3 ThatOneDork 2018-03-17
🌽🌽🌽
3 IgnitedSoulZ 2018-03-17
Hey guys just a reminder, remember when qanon said follow the white rabbit? Idk just something to think about i guess.
3 JeffsDad 2018-03-17
There's a podcast about a creepy arg called Rabbits
1 Arszilla 2018-03-17
Mind sharing the link?
3 JeffsDad 2018-03-17
Rabbitspodcast.com
2 Arszilla 2018-03-17
Will add that to the post when I wake up
1 SwiggittySwoot-E 2018-03-17
Teach me to reddit in my sleep senpai
1 samjaam 2018-03-17
This whole thing reminded me of this podcast, if u have Google play you can just search rabbits under podcasts, maybe a regular Google search will turn it up
3 O-U-A-P 2018-03-17
What a WILD story. I’m inclined to think more than one hoax/bamboozle is going on here. Waiting to see where the Cicada angle leads.
3 IgnitedSoulZ 2018-03-17
Thanks for the hard work OP. Can people back this post so it doesnt magically get deleted.
3 47dniweR 2018-03-17
Was just thinking about the strange rabbit references, and remembered there is a podcast about a mysterious game called rabbits. Maybe this is somehow connected. This is from the description on the website.
"Rabbits is much more than just a game, and that the key to understanding Rabbits, might be the key to the survival of our species, and the Universe, as we know it."
https://www.rabbitspodcast.com/
1 ChairmanVee 2018-03-17
rabbit, or habit?
1 AceRedditerJames 2018-03-17
EMH?
3 obeythewafflehouse 2018-03-17
Is any of this being transmitted over radio? You know governments still communicate to spies to this day through encrypted messaging. Maybe someone picked something up and ran with it, but I doubt Twitter and YouTube would be platforms to choose to communicate.
2 MinxyKittyNoNo 2018-03-17
In a world that lives with their faces in their phones....why wouldn't it be? They would be the best platforms to reach humanity on.
3 SailorDak 2018-03-17
Agreed. Especially if this is alien life forcing disclosure upon us since our leaders are going slowly about it. I would absolutely figure out how to use a species’ most common method of information sharing to announce my arrival to all of them instead of revealing ships in the sky (shock value) or revealing myself to a select few (take me to your leader).
1 obeythewafflehouse 2018-03-17
Who's trying to reach humanity? Aliens?
3 cutiebug 2018-03-17
I made a discord:
https://discord.gg/qrNBqN6
3 FunHegemon 2018-03-17
This is awesome, great post.
2 Entropick 2018-03-17
Nice, comprehensive, thorough, plentiful. Hope this blows up for ya!
6 Arszilla 2018-03-17
Thank you. Spent past 2-3 hours editing, finding links, posts etc. Unfortunately Cicada370 vanished again, as I was linking its 26-29 tweets it posted (As it came active again within the past 5-6 hours it posted a lot of stuff, tweeting every 5-10 minutes)
1 stevenbarcynski 2018-03-17
What's new with This? We're close
2 CursedCode 2018-03-17
strayedaway/ty deleted his account
edit: or maybe he changed his name
4 Arszilla 2018-03-17
Probably deactivated for now as he was freaking out
2 shadowdarko 2018-03-17
Uploaded this collection of screenshots.
https://imgur.com/gallery/NxBZx
He has since started posting again, will update with more screenshots and try to order them chronologically. Edit: Changed the link to an updated and chronological version
1 Arszilla 2018-03-17
Please do. I'll log every post in Imgur and fix my stuff here.
2 CursedCode 2018-03-17
his collection got deleted
1 shadowdarko 2018-03-17
updated it!
https://imgur.com/gallery/NxBZx
1 beardbrawn 2018-03-17
I also see it as deleted. But by whom?
1 yayoglitter 2018-03-17
I'm pretty sure by him because if anybody else who wasn't him deleted the account it would say this account has been restricted or something but because it just doesn't exist now, that means he did.
2 MaliciousKaz 2018-03-17
What's up with the rabbits?
Italian coordinates mentioned. http://www.italianways.com/the-pink-rabbit-in-colletto-fava/
1 MaliciousKaz 2018-03-17
https://www.youtube.com/watch?v=e_1haffjVWI&feature=youtu.be
3 purplemonkeydisheZ 2018-03-17
What the fuck go watch the “water heater” video on their playlist. There is a dead body.
1 efranch 2018-03-17
WORD this shit freaked me out
1 tstock415 2018-03-17
That's the rabbit from the chrildrens book, goodnight moon too
2 beardbrawn 2018-03-17
Knew I recognized it good catch. Thought it was from peter rabbit or something.
2 JordanMckee 2018-03-17
Just realising that before Cicada370 deleted their account again, they posted something that said "We are LunarRabits"
well, look at this.
see a connection?
3 Steve_Evo 2018-03-17
https://www.google.co.nz/amp/s/www.bbc.com/news/amp/world-asia-china-36972205
China's Jade Rabbit has bid its final farewell and shut down after 31 months exploring the Moon, far outliving its expected lifespan.
2 Arszilla 2018-03-17
I knew something was up with that rabbit, QR code and the moon from that vid.
1 purplemonkeydisheZ 2018-03-17
Watch the water heater video on their playlist. There is a dead body, also the video titled chair has a person strapped to the chair at the 2 seconds remaining point.
1 Arszilla 2018-03-17
Link it?
2 purplemonkeydisheZ 2018-03-17
water heater video with dead body
3 JunkyardForLove 2018-03-17
Wtf
1 epikninja123 2018-03-17
That's a body that was recovered from the lost Franklin Expedition in the Northwest Passage.
1 purplemonkeydisheZ 2018-03-17
person in chair at 16 second mark
2 [deleted] 2018-03-17
[deleted]
2 HelperBot_ 2018-03-17
Non-Mobile link: https://en.wikipedia.org/wiki/Malaysia_Airlines_Flight_17
HelperBot v1.1 /r/HelperBot_ I am a bot. Please message /u/swim1929 with any feedback and/or hate. Counter: 160834
2 Arszilla 2018-03-17
Triangles? What do they mean?
1 CursedCode 2018-03-17
why was his post deleted what the fuck
2 Arszilla 2018-03-17
The fuck? I just had it, and I dont see it in my
all
messages in a tab that I opened 5 mins ago.1 beardbrawn 2018-03-17
something about triangles are easy? simple? something like that.
1 QuitUrAddictionNow 2018-03-17
If you watch secureteam10 and all the UFO footage he posts - most of it is described by 3 lights in usually a fixed triangle formation. I think most of the UFOs captured on video in the night sky are almost always in some kind of triangle formation.
2 ErichlllZann 2018-03-17
I admittedly skimmed the top post so I may have missed this, but has this video been mentioned in here yet?
https://youtu.be/bs-h-n8Tmcg
I came across it on one of the Twitter threads last night. Comments should explain...
1 cassious64 2018-03-17
This freaked me right the fuck out
2 xtoemaytoetoemahtoex 2018-03-17
I have been following him up date and his account is gone. Probably due to high traffic, it could be due to that person who took pictures of his house and the threats of him not taking down the call from his phone. I took a video of that call he had so now it's on my phone. I have it saved on my phone and on a different phone.
Everything concerning this subject is completely void on Facebook. Every time I posted something about it since last night, it got taken down.
1 Arszilla 2018-03-17
He deactivated his account cause he couldn't handle it
1 xtoemaytoetoemahtoex 2018-03-17
That was my first thought. He posted telling people to unfollow him and get off the theory kick so that's highly likely.
2 thelambhamster 2018-03-17
Just saw that the Malaysian aircraft was found???? Is this real?
3 Arszilla 2018-03-17
Only thinf I found is
https://www.google.ro/amp/s/www.dailystar.co.uk/news/latest-news/689358/MH370-news-Malaysia-Airlines-search-found-Google-Maps-location/amp
2 thelambhamster 2018-03-17
Im a bit confused on how the videos with the water heater and dead body connect to this.
2 Arszilla 2018-03-17
Videos shared by QR codes/from accounts connected to Hijj
1 thelambhamster 2018-03-17
Do you think it is connected to this in some way? Any theroies on what the Rabbit deal is? I hope this isnt connected to Valve or Portal, unless its something deadly.
1 Arszilla 2018-03-17
No idea on the Rabbit deal
The videos/accounts kept going to MH370 then MH17. Some fellas and I found a 'link'. An anomaly happened 10 days after MH17 was downed. https://imgur.com/gallery/wmoBF
1 ayyyee9 2018-03-17
Someone needs to fly a drone or two down that hole.
2 Nascarfreak123 2018-03-17
The more I look into this the more it feels like an ARG. Also have something that could prove it’s an ARG, I saw a twitter reply stating the original account that sent the “delete the message post” was already created a while earlier: I think by a couple of weeks
1 BestCry 2018-03-17
What is an arg?
1 TheUplist 2018-03-17
An "Alternate Reality Game" ?
2 BestCry 2018-03-17
Thanks
2 dargen_dagger 2018-03-17
Anyone brought up twitter user @DRT8190729 ?
2 Arszilla 2018-03-17
We are looking him up (A group of 10 redditors)
2 dargen_dagger 2018-03-17
Let me know if anything comes of it
2 PradaSentinels 2018-03-17
01:57 AM Indonesia Time.
The Account has back. Some images, QR Codes, videos has been updated.
In this Video someone made reverse the video. I do my best to translate them. And the translate is "lunar is home with space triangles are built with hast"
EDIT : This post made me thinks if he/she doing all of this was prank and troll.
Some QR Codes leads to photo of the Part of the Moon and some other lead me to another QR Codes.
EDIT 2 : He made this tweet
2 Arszilla 2018-03-17
I am trying to document everything and update my post here but damn he is fast.
Also sounds like the video is reversed. Re-reverse it?
1 PradaSentinels 2018-03-17
Yes it is, The video is reversed. I saw someone in the reply section made a version of re-reversed.
1 Arszilla 2018-03-17
Post has been updated. We were analyzing the tweets and getting to places.
2 50Shekel 2018-03-17
I'm convinced it's just a piece of the 2018 puzzle.
2 Pidjesus 2018-03-17
Reports coming out that some guy has apparently found the plane... way too much of a coincidence with this twitter thing all happening
1 Bee_Monkey 2018-03-17
Source?
1 noflyman 2018-03-17
Gotta link bud?
2 J1thegame 2018-03-17
https://www.mirror.co.uk/news/world-news/missing-flight-mh370-found-google-12205561
3 Pidjesus 2018-03-17
cMahon told Daily Star Online : “Four Americans were sent to Australia to oversee the findings of MH370.
“They have made sure that all information received has been hidden from the public, even our government – but why?”
McMahon says authorities “do not want it found as it’s full of bullet holes, finding it will only open another inquiry”.
Ghyslain Wattrelos lost his wife and two children in the tragedy. He believes the plane was shot down.
He thinks Vietnam, Malaysia and Thailand could be withholding vital information.
Ghyslain said: “All the military from these countries have seen the plane, if we believe that version. Why are they silent?
“I do not know, but there are also other countries that have information like England with Inmarsat, with Rolls-Royce, like the United States with Boeing and like the FBI who went the next day and took the pilot's flight simulator and never said anything to the investigators.
“Why this silence? There is something we do not want to say in this story.”
2 noflyman 2018-03-17
Thanks
1 FergusonBerguson 2018-03-17
Yikes, that site was rough on mobile. I wonder if that’ll pick up traction/if anyone will actually search that location.
2 samjaam 2018-03-17
Has anyone emailed the hotmail account?
2 Arszilla 2018-03-17
We did. We are awaiting a reply.
https://i.imgur.com/ocePQ4R.png
1 Griiffiin 2018-03-17
Did you try both with the NATO words all spelled out and with just regular letters?
1 Arszilla 2018-03-17
NATO words stand for letters mate.
Alpha: A
Bravo: B
etc.
Thats how the email is not that long. Its actually “weather@outlook.com”
1 Griiffiin 2018-03-17
Yeah that’s what I meant - I was making sure you sent it to that email as well as spelling all the words out just to cover all your bases!
1 Jbnzz 2018-03-17
I did. No reply yet
2 _Kofiko 2018-03-17
I'm spooked
2 samjaam 2018-03-17
New tweet "Hijj Ends Cicada Continued"
3 Griiffiin 2018-03-17
So that account is Cicada.. but it’s almost like Cicada saw this getting big and used it as an opportunity to promote their new mystery or whatever.
I don’t know how many different things we’re really dealing with here it’s all over the place.
2 samjaam 2018-03-17
Put no pgp signed message ... not sure if it's 'offically' cicadia but sticking around
2 Griiffiin 2018-03-17
I’m about to reply to one of their tweets asking if we can get some sort of PGP signed message.
2 Nascarfreak123 2018-03-17
https://www.reddit.com/user/skimmer47/comments/8523q4/you_need_to_act_quickly/
What do you guys think of this? It was created right around the messges coming online1 KorteMoeder 2018-03-17
I was reading on it earlier and went out to try to snag the address. I can not get back to it. Says it has been deleted.
2 SevenDeadlyCyns 2018-03-17
Cicada is back, it seems
2 samjaam 2018-03-17
Apperently they opened dm's for questions ..
1 Arszilla 2018-03-17
Wrote to them to provide the PGP.
1 samjaam 2018-03-17
Same .. wouldn't mind a puzzle solving arg but don't pretend to be cicada
2 Pidjesus 2018-03-17
From their twitter:
'We haven't said yet that this isn't connected to MH370'
'×This Event is no where related to catastrophic events × 18 april is definitely safe ×All other accounts are impersonating ×reason to hold this event is to help people solving a upcoming global cicada event ×reason to hold this event is to aware people with knowledge'
Yet the shit they've been posting has been linked to MH370 (dates) and they've been linking things about 18th April, fuck this
1 Arszilla 2018-03-17
They didn't say MH370
That is what they wrote.
1 Pidjesus 2018-03-17
The tweet got deleted, it was a reply to someone else saying 'We haven't said yet that this isn't connected to MH370'
1 Arszilla 2018-03-17
Account is gone mate.
2 FetusViolator 2018-03-17
Maybe April is the day TeamFourStar will release the Dragonball Z Abridged season finale for the Cell Saga.. makes sense since he's a cicada and everyone dies..
Stay woke everyone
2 Sierrastewart 2018-03-17
Do we have a Discord for this yet?
2 Griiffiin 2018-03-17
If a discord gets started lmk
1 Arszilla 2018-03-17
No. But take all this with a grain of salt tbh
2 Sierrastewart 2018-03-17
I absolutely am, ha. It’s quite a bit of fun to keep up with, though. Would be fun to have a Discord to keep updated in real time.
2 miqdad1 2018-03-17
@cicada3311 is Gone Again
2 Arszilla 2018-03-17
Yep. Probably gone due to I called them out for not having PGP signature in public.
1 Griiffiin 2018-03-17
I DMed them asking to post something online with a PGP they didn’t respond lol
3 Arszilla 2018-03-17
Same. Probably noticed they got called on their BS so ran away.
1 Griiffiin 2018-03-17
So what explains the rest of this?
2 Arszilla 2018-03-17
Don’t know. We gotta wait a bit I guess.
2 samjaam 2018-03-17
Account down ???? Wtf
3 Arszilla 2018-03-17
Yep. Probably gone due to I called them out for not having PGP signature in public.
2 Pidjesus 2018-03-17
CICADA370 > Hijj370 > CICADA331 accounts/tweets = confirmed fake now?
2 dmondo12 2018-03-17
Ok so if that hjij account whatever is fake then all that shit they posted means nothing right? However, what about the original voice mail and the guy taking photos?
2 Griiffiin 2018-03-17
Yeah and all the other weird accounts and videos
1 Arszilla 2018-03-17
Dont know but shit gets “fake” when they claim to be Cicada
2 jennayyy_26 2018-03-17
http://lunarrabbit.com
Maybe it is an elaborate advertisement or whatever for this game company? Their website is also copyrighted from 2016, when the lunar rabbit 4/18/18 video was uploaded.
2 Arszilla 2018-03-17
Well the people “lunarrabit” missed a b in “rabbit”
Then claimed to be Cicada without PGP and even opened DMs.
I am believing this was a decently made attention farm. We’ll see what happens in 15-16 hours I guess
0 SailorDak 2018-03-17
Follow the white Rabit Through the looking glass Their Gateway
1 Arszilla 2018-03-17
?
If you are trying to say Cicada3311 is legit, you gotta prove it mate.
They opened their DMs and did not provide PGP. Thats not the Cicada way
2 SailorDak 2018-03-17
Look to the documents released last year from the CIA.
1 Arszilla 2018-03-17
Mind linking/sourcing us?
3 SailorDak 2018-03-17
https://www.cia.gov/library/readingroom/docs/CIA-RDP96-00788R001700210016-5.pdf
2 KayleighEU 2018-03-17
What are these? Are they real??
1 SailorDak 2018-03-17
That is the CIA’s website, no?
1 AlvinItchyCock 2018-03-17
Is this some sort of remote viewing session or something?
1 SailorDak 2018-03-17
This one in particular is an internal research paper. The casualness of the verbiage reeks of normalcy — being something that they have come to accept as a matter of fact in this particular document.
3 SailorDak 2018-03-17
https://www.cia.gov/library/readingroom/docs/CIA-RDP96-00788R001900760001-9.pdf
1 SailorDak 2018-03-17
/u/arszilla in ref: “We are them”
5 Arszilla 2018-03-17
Damn.
Mentions the pyramid and rabbits...
1 SailorDak 2018-03-17
Indeed it does. You need to dig deeper.
1 zingrat28 2018-03-17
Where does it mention the Rabbits?
1 Arszilla 2018-03-17
Towards the end of page 4. Last paragraph for SUB
1 hxczach13 2018-03-17
Whoaa excuse me? Sounds almost like a dmt trip.
2 SailorDak 2018-03-17
No, it is a government document of a remote viewing session which was facilitated by an official.
1 hxczach13 2018-03-17
I didn't mean that it actually was one, just stating the similarities in his responses to his surroundings.
2 rhayannbee 2018-03-17
Update: Cicada3311 got deleted.
3 Arszilla 2018-03-17
Deleted or name changed?
If deleted it is because of this:
http://prntscr.com/isn4jk
2 neomatt24 2018-03-17
So I did some research on the County Bluff youtube account, and I will tell you that the filming location is in Utah, the counties listed in the Weather cast video state Morgan Valley, Weber County, and Ogden. I also reversed and sped up the audio for the Chair video and it states "Don't Forget" very clearly.
1 jamesseventwenty 2018-03-17
There’s definitely some interesting audio stuff hidden in those vids - I’m interested to see what that voice is saying in the boiler one too
1 neomatt24 2018-03-17
Alright I will start working on that. Apparently my posts are getting removed because I am new, so I will reply here.
1 MsLydiaSchmidia 2018-03-17
Wheeler mortuary is in Springville Utah. Big rock candy mountain is as well.
2 Ravnuslock 2018-03-17
omg.. IT´S THE BEAST FROM THE EAST CATHY
2 -Economist- 2018-03-17
NIN did something on a much smaller scale for Year Zero.
1 Arszilla 2018-03-17
NIN? Year Zero?
2 -Economist- 2018-03-17
Nine Inch Nails...Year Zero album. It was not a traditional album. I don't recall all the details but I know some people found thumb drives in bathrooms at concerts that had vague info on the album
https://en.wikipedia.org/wiki/Year_Zero_(album)
1 SailorDak 2018-03-17
He was envisioning what a post bush era would look like in 2020. The event was also spotted with mock kidnappings and swat invasions of the concerts.
1 -Economist- 2018-03-17
The album would have worked just as well with Obama however he'll need an entire new album for the post Trump era. lol
2 fizzlefuzz 2018-03-17
https://www.youtube.com/watch?v=G2xXu8_2Exo
3 astralfoto 2018-03-17
Seems legit
2 ajws7036 2018-03-17
After further digging, I can confirm It was indeed posted before his death
1 Arszilla 2018-03-17
Wait wtf. Can you prove it? So I add it to the post.
This is major if true
2 MinxyKittyNoNo 2018-03-17
Bricks will be shat. Bug-out bags are packed.
1 IgnitedSoulZ 2018-03-17
Before whos death? Sorry i skim read the post.
3 Arszilla 2018-03-17
Professor Stephen Hawking.
The accounts (That messaged Ty) had mentioned stuff, regarding MH370 and Hawking’s Death.
Hawking died the next day.
2 hxczach13 2018-03-17
from what I can see it was the same day, he woke up to the texts, this page shared it yesterday, so that would place the texts late Thursday night/early Friday morning.
1 thelambhamster 2018-03-17
I had the screenshots from a huge post on facebook and sent them to brother. They are now deleted?!? Weird. How can they confirm it was before his death? I dont see any links?
2 tkowalski 2018-03-17
I made have missed it, but where is the direct mention of flight 370 from the original account? I may have missed it but was under the impression that the connection was being inferred and not a direct mention
2 Arszilla 2018-03-17
Well it kinda started with Hijj370 AKA Cicada370 AKA Cicada3311 posting this video on their profile. Users took it and reversed it.
This is the result.
https://mobile.twitter.com/drwsdrizzyy/status/974644540475834369
2 SailorDak 2018-03-17
How can we be certain that Hijj370, Cicada370, and Cicada3311 are all one and the same?
2 Arszilla 2018-03-17
The accout just changed names. I and many people can vouch for it. Been following the account for 2 days now.
2 SailorDak 2018-03-17
It just seems like completely different writing styles and tone between Hijj and 3311. They also feel contradictory to one another.
It just doesn’t seem cicada at all — but I feel like that would be the nail in the coffin for this. At least, if it was me in the position of damage control of this unintentional leak, I would let it continue under the guise of an ARG... problem solved.
1 Arszilla 2018-03-17
Many dont believe its Cicada either. There is no PGP like the previous Cicadas and this Cicada accepted DMs for a brief time. Even replied to the tweets.
2 dantxx 2018-03-17
theres has been reports of lights over governador valadares right now. parents that live in brazil confirmed
2 Arszilla 2018-03-17
Videos etc?
I believe at one point we talked about brazil here
2 hxczach13 2018-03-17
That's where the text from that Facebook group mentioned.......
1 dantxx 2018-03-17
trying to find something using the geo tag on instagram, but just people happy drinking etc living their lifes on saturday night.
but something weird is going
1 SailorDak 2018-03-17
Definitely something fishy... people drinking on a weekend? Wtf???
1 hxczach13 2018-03-17
What did your parents say exactly? Don't get my hopes up lol.
2 samjaam 2018-03-17
Ok fucked up, translated the hex from the video on Steven M YouTube account and there is hex correspondence related to the weather@outlook.com email, and then changed email to orbiting@rediffmail.com , all in phonetic alphabet. Will upload links in a bit
2 samjaam 2018-03-17
https://imgur.com/gallery/zKlFb
2 1androidofzexal 2018-03-17
vro the @cicada3311 acc was following my twitter, https://twitter.com/andrew_v69, i'm the only one they were following within the past 24 hours. also they sent me a DM saying "welcome to 3311" on god
8 NotMySeventhAcct 2018-03-17
Cool, now post a picture of it
1 1androidofzexal 2018-03-17
correction: were following. they unfollowed me a few hours after they sent me this DM. sorry for not responding/clarifying, i don't use reddit. proof: https://gyazo.com/e901b56e4efc38d58f3bee2de05ec8a8
you can't send me a DM unless you're following me.
1 Gyazo_Bot 2018-03-17
Hi, I'm a bot that links Gyazo images directly to save bandwidth.
Direct link: https://i.gyazo.com/e901b56e4efc38d58f3bee2de05ec8a8.png
Imgur mirror: https://i.imgur.com/Zs95osv.png
Sourcev2 | Why? | Creator | leavemealone
2 rebuilt11 2018-03-17
Either government application code. Spy signals. Or crazy larp
1 tipstr 2018-03-17
It has been going on for a wile on twitter, giving us hexadecimals, ascii85, qr codes, and so on. Riddling us regarding MH370, aliens, UFO`s and so much more.. Has been fun up until the accounts where gone..
1 CursedCode 2018-03-17
Does anybody know if @strayedaway/Ty is okay? He hasn't posted anything in 12 hours. Hopefully, he's okay and he's just hiding.
3 Arszilla 2018-03-17
/u/lmgbylmg is his buddy. Any news mate?
2 lmgbylmg 2018-03-17
I just saw he deactivated. I’ll text him.
2 Arszilla 2018-03-17
Please do. At least let him know we need to screenshot the tweets so we can archive them, if he doesn’t mind. For the sake of progression and knowledge
Tell him to contact me via PM here so I can coordinate with him
4 lmgbylmg 2018-03-17
someone on tumblr has screenshots, but i lost the post. ill go look for it. and he tells me hes ok, just needs space and to not believe any accounts with names similar to his
2 Lions_for_life 2018-03-17
He just tweeted this
1 King0fThoseWhoKnow 2018-03-17
Its, gone, you remember what it was?
1 Lions_for_life 2018-03-17
It just said good morning to the girls who stole a bus from vine or something like that.
1 TrippySubie 2018-03-17
His account is no longer loading any tweets
0 Lions_for_life 2018-03-17
Huh. I wonder if he deleted it because he didn't want to deal anymore or maybe because someone made him do it.
2 TrippySubie 2018-03-17
Yeah, theres a lot of shit getting deleted now. Most links posted here ended up being 404’d or deleted tweets. Im still unsure if I want to believe this, but at the same time I want this to be real....okay maybe if theyre deadly aliens then nope.
1 HatesRedditors 2018-03-17
There's a good Reply All podcast about what this might be, they play spooky but compelling bits of audio that makes a listener stay on the phone longer for some 800 number scheme.
Podcast link below:
https://www.gimletmedia.com/reply-all/104-case-phantom-caller
1 [deleted] 2018-03-17
[removed]
1 ayyyee9 2018-03-17
Are you ready to share friend?
1 alphex 2018-03-17
Please update.
1 CursedCode 2018-03-17
update: https://twitter.com/hijj370 is back up
1 Arszilla 2018-03-17
Post updated. Thanks for the info. Will grab a bite to eat and update my post and list all the tweets in Imgur.
2 [deleted] 2018-03-17
[deleted]
1 Arszilla 2018-03-17
Link?
2 [deleted] 2018-03-17
[deleted]
1 Arszilla 2018-03-17
So from MH370to MH17?
1 CursedCode 2018-03-17
account is gone again, but two new videos
1 Arszilla 2018-03-17
I just wrote that, noticed it as I came from dinner and to update my post. What 2 videos?
1 CursedCode 2018-03-17
first reversed video: https://twitter.com/EggerdingEmily/status/975040969270874112 second one was nato code i can't seem to find it
1 Arszilla 2018-03-17
Page gone.
1 [deleted] 2018-03-17
[deleted]
1 Arszilla 2018-03-17
Yea. Updating the post with Imgur links aswell. Give me a bit. Lots of images etc to take and info to change.
1 shadowdarko 2018-03-17
got all the vids up on my imgur link https://imgur.com/gallery/NxBZx
1 Arszilla 2018-03-17
Are these in chronological order?
1 shadowdarko 2018-03-17
Yeah, it's top to bottom newest to oldest. I couldn't get a lot of the originals though because I started after his first deletion.
1 kittensarepink 2018-03-17
And gone again
1 JordanMckee 2018-03-17
cicada370/hijj370 posted this which, when reversed, says this. July 17th, 2014 is the date that the flight MH17 went missing.
I personally think that the cicada account and the voicemails are entirely unrelated - perhaps people saw an opportunity to create an ARG from the conspiracy theory of the voicemails. I wouldn't panic too much.
1 Arszilla 2018-03-17
The date MH370 went missing was 7/8th of March 2014. Does that mean the passengers and the plane was somewhere “safe” for a few months? Then something happened?
1 JordanMckee 2018-03-17
it was definitely July 17/18th - it's on the BBC news website and several others.
2 JordanMckee 2018-03-17
EDIT: I'm dumb. The flight 17 went down on July 17th. Not the flight 370. I READ IT WRONG
1 Arszilla 2018-03-17
Well maybe those 2 are somewhat connected or related? I mean MH17 was shot by Ukranians though
1 mywarthog 2018-03-17
Anyone got a link to the original voicemail? Looks like he deleted the tweet. Curious to hear it myself.
1 Arszilla 2018-03-17
I will link it. Maybe from some youtube videos.
Ita a female voice, robotic, saying the message with “Sierra Oscar Sierra” etc
1 JordanMckee 2018-03-17
Cicada370 posted something (that I was too late to view) before deleting his account again
1 Nerfmatrix 2018-03-17
i ran the qr codes Hijj370 posted through a qr reader. bigger qr this one gave me a series of numbers or letters that i ran through google and it led me to chapter twelve of War of the Worlds. ch 12
small qr this qr code led me to this site last words shits spooky my guys
1 Gyazo_Bot 2018-03-17
Fixed your link? Click here to recheck and delete this comment!
Hi, I'm a bot that links Gyazo images directly to save bandwidth.
Direct link: https://i.gyazo.com/a16c3781861b2b82960b49ecff3c3e84.jpg
Imgur mirror: https://i.imgur.com/FrzUCxQ.jpg
Direct link: https://i.gyazo.com/ecf51d156c41d768735f5acefff91e37.jpg
Imgur mirror: https://i.imgur.com/iBGeiDT.jpg
Sourcev2 | Why? | Creator | leavemealone
1 NeverAgainNora 2018-03-17
I listened to the final hours of Japan Air 123, the whole thing. The last words the pilot said was "This is it. I'm sorry. Goodbye" while the alarm kept saying "Terrain. Pull up. Terrain Pull up." You could also hear the pitch of the air thinning between the plane and the ground. So chilling that I'm shivering right now. And to think that their government knew were it crashed and didn't think to look for survivors because they were convinced that no one survived. When they did make a recovery search, the medical team discovered that a good number of them lived for at least an hour or three afterwords but died from exposure. So sad.
1 TommyHeizer 2018-03-17
Hey, I found that account : https://twitter.com/Bdbxtjmsa1
1 Arszilla 2018-03-17
Was about to add that to the edit as it became active again. Thanks for pointing it out though.
1 BikDikGangsta 2018-03-17
Grant us eyes...
1 J-ToThe-R-O-C 2018-03-17
ahhh...mother Kos... or as some say... Kosm..
1 SepticPotato619 2018-03-17
Gritter 3.0
1 Arszilla 2018-03-17
?
1 SepticPotato619 2018-03-17
Sorry, meant "The Grifter 3.0"
1 Arszilla 2018-03-17
What is that?
1 SepticPotato619 2018-03-17
The scariest, most inhumane video ever
2 CursedCode 2018-03-17
send? cicada370 said 3.0 starts now. later he said 5.0 starts now.
1 SepticPotato619 2018-03-17
I don't have it anymore, (didny want to get vanned) if you search the hole long enough, you might find it.
1 Pidjesus 2018-03-17
What was in the vid out of curiosity?
1 Waffle_Bat 2018-03-17
I haven't heard of this. Care to summarize for us?
1 valincx 2018-03-17
I don't know if it's worth adding, but I saw the posts about this yesterday and thought nothing off it.
Now my friends on Facebook are sharing posts about the "SOS it is dire that you evacuate" posts on Twitter.
So that means it's getting very popular. It's starting to feel like some kind if psy ops craziness.
4 Arszilla 2018-03-17
Psy ops for what?
It is getting popular due to multiple reasons; one being Ty’s situation
Its normal, we just gotta go down this rabbit hole
1 valincx 2018-03-17
I said "it feels like some sort of psy ops" not that it was. It just sorta seems, uh too convenient to be getting popular. This kinda thing just doesn't get popular on Facebook.
Yet it's got publicity for some reason amongst the mindless meme sharing that is the book.
1 bre1345 2018-03-17
i really hope this gets figured out, I've been obsessing over it all morning and afternoon. If it is fake how did this person get the original poster on Twitter's number?
1 accountforthetrash 2018-03-17
I've been checking out the youtube videos from County bluff There's the video 4/18/18 showing the moon, a rabbit in a chair, and the words THINK HOME. Then checking the Song for jack video in the description in NATO it says SOS APRIL VIEW THE MOON. If anything is set to happen with all this we'll have to wait till that night and see. I'll definitely be spending all night outside staring in the sky. If anyone has a good telescope set it up to the moon and maybe set up a live stream for people to see. I really hope this isn't an ARG or something a long those lines.
1 muskrat0110 2018-03-17
County bluff seems to be uploading rather frequently now
1 Chocolat3_giddyup 2018-03-17
@half_baked2010
1 Canadianstoned 2018-03-17
Has anyone looked into the numbers in countrybluffs description? the moon video title has them and the description of weather cast and antlers,
1 AmishAtomicPhysicist 2018-03-17
Ty mods for mega thread.
1 hxczach13 2018-03-17
Colvetta Fava had this weird thing.
2 Arszilla 2018-03-17
We mentioned it in the thread.
1 HelperBot_ 2018-03-17
Non-Mobile link: https://en.wikipedia.org/wiki/Colletto_Fava
HelperBot v1.1 /r/HelperBot_ I am a bot. Please message /u/swim1929 with any feedback and/or hate. Counter: 160873
1 [deleted] 2018-03-17
[deleted]
1 Arszilla 2018-03-17
Mentioned in the thread already. Water heater with a dead body video (See Interesting Stuff part of the thread)
1 pepsiinjester 2018-03-17
http://www.mobi-antenna.com/uploadfiles/2017/09/201709131821392139.pdf
What's interesting is that a search of this video brought me here.
https://www.youtube.com/watch?v=e_1haffjVWI
4/18/18 556e68756d616e20657272
on duckduckgo.
1 Napoleon-1769 2018-03-17
I’m just here for the spooks, but, Cicada is a strange username to show up on a puzzle like this. Cicada3301 was (maybe still is) a HUGE riddle similar to this but on a different platform. I don’t know if it was ever solved, for I dropped out of the race to figure it out to solve personal issues. Best of luck y’all, just thought I’d throw that in.
1 AlwaysDankrupt 2018-03-17
there hasn't been a new cicada 3301 puzzle in a while, maybe its related? whatever it is it's creepy as fuck
8 Griiffiin 2018-03-17
Definitely
Only reason I don’t think it’s for something like Portal or Cloverfield is because neither of them would make reference to a real life plane disappearance where people lost members of their family - seems disrespectful and I don’t see them doing that.
0 zuukinifresh 2018-03-17
Fair but if they handed the PR of the ARG over to a firm or even they may have felt it was enough to grab attention
1 Griiffiin 2018-03-17
Is there a subreddit for all these findings?
6 BisquickBiscuitBaker 2018-03-17
You're in it.
1 pepsiinjester 2018-03-17
weather@hotmail.com Just curious if anyone has tried to email this yet?
You seem to know too much about things. You will have to explain what and how you know. whiskyechoalphatangohotelechoromeo@hotmail.com
It came from one of the QR codes.
1 Pidjesus 2018-03-17
If this is all one hoax why was there MIB outside the guy's house taking pictures?
4 zuukinifresh 2018-03-17
He lied?
3 neverwinterblight 2018-03-17
It was part of the making of/elaborate setup. It's not far fetched to have this planned in advance.
1 TheUplist 2018-03-17
Go look into LHO or Laughing Horses Orafice.... It's an art group that really is just a director and his friends. They made a lot of fucked up art and made a bunch more fucked up websites all registered to "Bob".... These websites are kind of meant to make you think there is a conspiracy of some sort. Really Graceful and BadGuacamole got caught up in the LHO stuff when pizzagate broke last year.. because several people on 4 Chan were posting the LHO links as WikiLeaks evidence. (yes, they were trolling )... Grace later figured out that the director of the movies is highly regarded in the Chicago , DC, and Houston art scenes and these websites were only made to troll.... Then grace and guac found sexually suggestive (of minors) art that the director had shot and been praised for (legal but very gross). Was it LHO a conspiracy?... No... Was it entirely separated from pizzagate? Yes and no. Here's one of the movies made by Laughing Horses Orafice https://youtu.be/dROz_uKxgTE
What's my point here? Is this QR thing an art project? I don't necessarily believe it is at this moment, but there are groups out there that would rather have people waste the than look for truth. This all looks more menacing than LHO, so I'm looking elsewhere for explaination. I really thought this vid I posted was fucked up. Guac gave it to me last year as I was supposed to run his subreddit (but he disappeared). Thanks for considering.
1 Bellxeight 2018-03-17
HEY His name on Twitter is a sort of anagram for “pyramids are home.” My account is too new, I can’t post. Please add to Op that there’s a genius kid in Russia who swears the pyramids have alien life inside and we just discovered there’s a void inside the Sphinx and he says that he’s an alien!!! https://youtu.be/oKDFdSmLb0k https://i.imgur.com/6h3WEbc.jpg
1 Fdavis2 2018-03-17
The guys twitter is gone .....
1 Arszilla 2018-03-17
Its back as Hijj370
1 Skynet3301 2018-03-17
I'm really curious as to whether this is a real phenomenon, or simply just a LARP/ARG/hoax.
1 loves2splooge- 2018-03-17
That water heater video ruined it completely. The “dead body” is a mummy named John Torrington
1 StefanYellowCurry 2018-03-17
tmi
1 kgs1977 2018-03-17
Wow thanks for all that work, interesting whatever it is
1 brindin 2018-03-17
Pretty interesting stuff. But from what I know from prior elaborate sequences of encoded messages, this is almost certainly a hoax of some sort
1 Nascarfreak123 2018-03-17
What prior sequences?
1 brindin 2018-03-17
Just any number of similar instances to this. It just seems like whenever there’s something that’s far too elaborate, with a number of over-the-top weird images or videos, it’s always some sort of contrived bullshit (but still attention-grabbing nonetheless). Just looking at the situation here, we have a bunch of encoded messages in a bunch of different types of code. Why bother using a bunch of different types of encoding to get the message across?
https://mashable.com/2009/07/15/internet-hoaxes/#K1u8.fo2USqP
1 giraffactory 2018-03-17
Seems like an alright arg. I've had worse.
1 Shenotix 2018-03-17
Hello! I come from YouTube with a pretty decent investigation into this case (I hope at least). Sorry if it looks like advertising but it's a small contribution from my part.
Here's the link: https://www.youtube.com/watch?v=M3j78ryw9Yw
1 Arszilla 2018-03-17
Its now linked to Cicada (not officially) so might wanna trash that I guess
1 MWValo 2018-03-17
Super interesting. Keep me posted.
1 MoonRey1 2018-03-17
Update hijj just made another post saying hijj ended cicada continued
1 Nascarfreak123 2018-03-17
/u/Arszilla will you add the reddit post that I linked?
1 Arszilla 2018-03-17
Which post?
1 Nascarfreak123 2018-03-17
If you don’t want to it’s fine
1 Arszilla 2018-03-17
You didn't send a post.
1 Nascarfreak123 2018-03-17
Oh sorry I thought you saw it I posted it in the comments earlier
Here it is https://www.reddit.com/user/skimmer47/comments/8523q4/you_need_to_act_quickly/
1 rhayannbee 2018-03-17
Cicada Reborn
1 Arszilla 2018-03-17
There is no PGP signature vs the other Cicadas so...
1 Kat_Sandraa 2018-03-17
Whoever wrote the Latin doesn't know the language
1 Arszilla 2018-03-17
I used a translator. My bad if its incorrect but I tried so...
3 Kat_Sandraa 2018-03-17
No I mean, the person who sent the text doesn't know latin. It should be "omnes nostri morientur" all of us will die. It should also be "malum depellendum est" which would be "there is a need to drive out the bad thing".
1 godlyatleague 2018-03-17
Could be many things trying to sway the main subject off course now.
1 Arszilla 2018-03-17
They stated that the account was here to stay now.
Well guess who said /r/quiteyourbullshit
1 ajws7036 2018-03-17
Can confirm the Stephen hawking Morse code, I translated it and replied back to the tweet, it's on my account ajws7036
3 Arszilla 2018-03-17
Thanks! Was it posted before Hawking died? Thats what I can’t confirm
1 ajws7036 2018-03-17
It was posted after his death
1 Arszilla 2018-03-17
Ah rip. I recall the date being 13th of march if not past midnight.
1 PradaSentinels 2018-03-17
I think the account trying to say that he doesn't related to Official Cicada as he say. "×It will be continued in 16 hours
×Everything that's unrelated to the quizzes will be posted in English
You will need to back up previous tweets for future quizzes
×reason to hold this event is to help people solving a upcoming global cicada event
×reason to hold this event is to aware people with knowledge"
I my opinion, they trying to say that they want us to helping each other when Cicada happend, as he stated that "reason to held this event help people to upcoming Cicada event"
The only thing i don't understand from voice mail, missing Malaysian plane (MH370) suddenly related To Cicada.
cmiiw. i am a bit new into conspiracy-thingy.
1 Arszilla 2018-03-17
I mean from what I understood from the tweets as I screenshotted them is that previous messages etc were for the real puzzles @Cicada3311 were gonna post but they turned out to be phony so...
1 PradaSentinels 2018-03-17
ah, i see
1 rhayannbee 2018-03-17
I see. I want to see the updates of this lol
6 Arszilla 2018-03-17
Same. From something intruging to a phony Cicada. Will the real Cicada respond? What will happen next?
find out in the next episode of /r/conspiracy!
1 RizlaTokes 2018-03-17
I would like to point out that unmistakable similarities between modern warfare and bf4 have already been connected with past events irl. woody island happens to be the largest island of the parcel islands, where bf4 has a map taking place on a large island with a crashed plane (bearing red stripe) surrounded by many smaller islands, taking place in the south China sea.
1 clickbeardsmile 2018-03-17
Forgive my ignorance - what does PGP mean?
4 Arszilla 2018-03-17
Pretty Good Privacy. Its a way of encrypting your messages.
2 clickbeardsmile 2018-03-17
Ah thank you! And thanks for all your work on this thread.
2 Arszilla 2018-03-17
No problem. Guess hours of investigation will go down the drain.
Oh well; had my midterms coming up.
1 klypspryngyr 2018-03-17
This is the only thing keeping me from actually WORKING on my midterms lol. This is my only excuse
1 Arszilla 2018-03-17
Well I had a hard time studying for my Analysis II class, and my brain said “Hey do a megathread and combine the work for some PI fun”
1 ekjohnson9 2018-03-17
Basic gestalt?
1 Dam-eJudyBrunch 2018-03-17
Has anyone looked into the symbols from the original tweet? Have it saved in my images not sure how to attach.
1 Arszilla 2018-03-17
Upload the images to Imgur then share the links here
1 rangoon03 2018-03-17
The picture of the dead body at 61 seconds here: https://m.youtube.com/watch?v=KvfbhxeeKfY
I swear I have seen this picture on a website before but I can’t remember where..
3 kabartanto 2018-03-17
Frozen body from an 1800's arctic expedition.
https://owlcation.com/humanities/johntorrington
2 rangoon03 2018-03-17
Bingo. Thanks.
1 Liv3_loud 2018-03-17
can you do a google pic search?
1 Supernova6 2018-03-17
next Cloverfield movie confirmed
/s
1 samjaam 2018-03-17
Twitters back folksss
1 HRCsmellslikeFARTS 2018-03-17
Rockstar?
1 KarlDilkington2 2018-03-17
Could this be why Kim Jung Un is relinquishing power to the U.S? The aliens are coming and all he has are some fireworks to throw at them? This could also explain the jump defense spending.
1 DNCsucks 2018-03-17
Can we get a TLDR
3 NotMySeventhAcct 2018-03-17
Someone in marketing is getting a raise
1 litrickmadthicc 2018-03-17
Pardon me if I missed this in the post above but I was looking at the country bluff youtube account and came across this other account under Steven M. m it’s really weird. And in the comment section there’s a bunch of comments with just numbers. Probably just nothing but wanted to share
2 Arszilla 2018-03-17
Those are hex
When I converted them:
And this video was uploaded in 2011. 7 years ago. Wtf? Could the description have been edited lately?
The description says “Jun 12, 2011”
1 samjaam 2018-03-17
Wow wtf ... Link to this?
1 Arszilla 2018-03-17
Just take the hex from the description of the video and look for “Hex to Text”
2 litrickmadthicc 2018-03-17
Translating some of the comments and it’s really creepy. It seems so unusual. One of the YouTube accounts names spells out moon. And they’re talking in hex about information and being under military surveillance and stuff.
2 Arszilla 2018-03-17
Can you share the links and info? Pics would go a long way.
Will add them tomorrow morning.
1 litrickmadthicc 2018-03-17
Yes want me to comment here? Or message? The link is the same to that video just in the comments
2 Arszilla 2018-03-17
Here would work.
Links, analysis, links to documents etc would prove useful so other redditors can see/access/analyze them as I sleep and I’ll take a look when I wake up
Also just noticed there are over 800 comments now. Most comments I ever had on any thread I posted. Oh boy, its a mess :/
2 litrickmadthicc 2018-03-17
https://m.youtube.com/watch?v=nFgH1srXtt0 Transcripts of the hexidecimal conversation on the comments of this video I came across this video after seeing the country bluffs videos. Note that the videos description was changed to June 12th 2011 and that all these comments came in the last 24 hours. The description in the video is decoded above.
Mike Oscar Oscar November “You seem to know too much about things. You will have to explain what and how you know. whiskyechoalphatangohotelechoromeo@hotmail.com”
Merlin Clark “The information is safe how can i be sure what you are saying is true. i request furthur information on the topic and i shall not share what i am told.”
Merlin Clark “Gnosis”
Red “You are under military and xAoxIwRob survaillanceerNot Human we Not human You will not go unharmed”
Merlin Clark “Prove it. Email me like we have been to this point.”
Merlin Clark “Are your comments important or just the other videos?”
Red “You are not quite aware with whom you are dealing with. I may be a valid source of information. See you soon. due to inconveniences from oppositioning party i have chosen to change our means of contact. oscarromeobravoindiatangoindianovembergolf@rediffmail.com”
Merlin clark “then why reply in hexadecimal then? and change your description as well?”
Red “so irrelevants can’t read our messages? Do not sway from the topic at hand. The account is hijacked and I will not do harm to the channel.”
Merlin Clark “If this is related to Cicada then make it known, You have no evidence to support any claims you are making. and the email you provided me with didnt exist, give me a method in which to contact you.”
Red “As aforementioned, I do have the evidence necessary. This could potentially help both of us. Essentially, I have figured out the last piece of the puzzle. I just cannot trust you with the information I possess as your account is obviously an alias of someone else’s. And again, the email is orbitingyou@rediffmail.com.
See you soon”
Steven M “It seems I do. But can you not say the same?”
Merlin Clark “What will happen to the moon April 2018?”
Mike Oscar Oscar November “We demand you to share any of your knowledge. What we do know dosen't matter. You know where to answer and you are pleased to use that email adress in order to keep those informations safe. We are not ennemies but we have to be sure any of those data is safe”
1 litrickmadthicc 2018-03-17
I’ll do what I can I’m translating the whole convo in the comments and I’ll retag it with a link to the video and how it was translated with the hex to text
1 samjaam 2018-03-17
Yeah I didn't see the link in the comment they posted lmao dont mind me
1 Arszilla 2018-03-17
Nah its fine.
1 samjaam 2018-03-17
Nvm lmao got it
1 litrickmadthicc 2018-03-17
Sorry I put an m for the link like an idiot lol
1 samjaam 2018-03-17
From the comments, is where we got the initial email from moon, I translated some and got another email, in phonetic alphabet - spells out ORBITING@rediffmail.com . "Due to some inconvinece from oppositioning party I have chosen to change our means of contact"
1 DNCsucks 2018-03-17
another fun LARP.
2 Arszilla 2018-03-17
Probably. The twitter is back. Lets see if we get a PGP
1 ajws7036 2018-03-17
I can look back through everything as much as it'll let me, let me check again. Kinda sucks everything's been deleted. I was almost positive it was before hawking died
1 Arszilla 2018-03-17
I am trying to find it from your tweets but no luck.
I am also sure its before Hawking died.
1 samjaam 2018-03-17
There was this big post going around with screenshots of everything on Facebook but I can't find it, I'm hoping I can it documented quite alot
1 H0n3yb4dg3r69 2018-03-17
Yea I think it got deleted. Not on my friends wall anymore
1 ajws7036 2018-03-17
I didn't save anything and it kinda pisses me off, I did all the translation while I was at work
1 Arszilla 2018-03-17
Couldn’t find it myself. Maybe gone with Ty’s messages?
1 ajws7036 2018-03-17
If it wasn't before, it was on
1 Pidjesus 2018-03-17
That's a shame, if it was before we could have found something huge
1 Arszilla 2018-03-17
But if it was on the day hawking died, time still matters. Hours before OR after him dying?
1 ajws7036 2018-03-17
Did some Google searching since their image caches haven't caught up with the page being deleted... It says the pic was posted "1 day ago" and that could mean 1 day or 1day and a few hours ago... Up to two days, in my experience. It's now the 17th, he was on FaceTime at 07:08 am, the DM was sent at 05:58 am. I just don't know what the caption for the posted pic was.. as in if it was a certain day
1 ajws7036 2018-03-17
Also you call check my [facebook](Facebook.com/ajws7036) , I just reposted it... I looked at one of the pictures. I couldn't tell whether the datestamp said 3/16 or 3/13 because only the tops of the numbers are showing and three and six look similar on the top
2 ajws7036 2018-03-17
just realized i've been commenting wrong, i am new to reddit
1 Arszilla 2018-03-17
I cant see the images
Better for you to you to upload them to imgur and remove your facebook
1 ajws7036 2018-03-17
http://imgur.com/KxJVTC7
1 thaibobatea 2018-03-17
It seems like the original poster of the video (@strayedaway) made another twitter account with the original video as the only post (@strayedaway_)
Not sure if it's real, most likely a fake, someone please verify, thanks
1 samjaam 2018-03-17
He said every other account is a fake he is going private, from my understanding
1 thaibobatea 2018-03-17
The new account was made a little over an hour ago, so while it could be fake, wasn't there someone who knows them irl in the thread somewhere? Hopefully they can verify it. I'm assuming it's also a fake, but we never know lol
1 Golden-Elevator 2018-03-17
here are some leaked files from the missing flight:
https://www.reddit.com/r/MH370/comments/5u6qr9/rmp_report_links/?st=JEW8QW5C&sh=bc0b8086
I thought they may be of use
0 AutoModerator 2018-03-17
While not required, you are requested to use the NP (No Participation) domain of reddit when crossposting. This helps to protect both your account, and the accounts of other users, from administrative shadowbans. The NP domain can be accessed by replacing the "www" in your reddit link with "np".
I am a bot, and this action was performed automatically. Please contact the moderators of this subreddit if you have any questions or concerns.
1 TheFatHat 2018-03-17
This is stupid, but could be an ARG for Destiny 2, as the ending cutscene featured space triangles and stuff
1 DrizztDo 2018-03-17
Destiny puts damn near no effort into their game as it is. I doubt they would invest the time on something like this. I miss Destiny 1 :(
1 TheFatHat 2018-03-17
I know right, a man can dream :(
1 prometheuswave 2018-03-17
Can someone try to do some research on that channel pop blast that was trying to expose Shane Dawson for nothing? I was going pee and I had an idea that the channel and the cicada puzzles from a while back are connected in someway
1 NotMySeventhAcct 2018-03-17
Why don't you?
1 prometheuswave 2018-03-17
Because I don’t have a reliable computer to do any background research into it, I get that I’m using a smart phone but anything that gets into code cracking fucks up and leaves me with a incomprehensible answer
1 Bleumoon_Selene 2018-03-17
My brother said this was confirmed by one of the people involved to be an ARG. Not sure if that's true or not.
1 samjaam 2018-03-17
People involved?
1 NotMySeventhAcct 2018-03-17
"people"
1 samjaam 2018-03-17
"Non humans?"
1 NotMySeventhAcct 2018-03-17
aliens
1 SailorDak 2018-03-17
Tell your brother lesson one in critical thinking is to trace and cite proper sources 👌🏻
1 The_Fad 2018-03-17
The OP literally says Cicada3311 said this was an ARG. We have as much reason to believe Cicada on that as we do to believe them on anything else.
1 SailorDak 2018-03-17
But also mentioned no PGP verification was provided.
1 The_Fad 2018-03-17
Right, which is why I said we have much reason to believe Cicada on that as we do to believe them on anything else.
1 Bleumoon_Selene 2018-03-17
Ehh, it was in passing. So I don't blame him for not bringing a spreadsheet up and detailing where he got it from.
1 LordPharqwad 2018-03-17
The account @cicada3311 that posted it being an ARG seems to be unlrelated to the voicemail that @strayedaway posted. Just someone trying to get all the traffic on there twitter
1 ChinaXpat 2018-03-17
At first when reading this I thought it was already April, and I was like 'holy shit, tomorrow is the 18th...I'm gonna go meditate', but then I realized it is March. Still got some time to Netflix n chill.
Take this with a grain of salt, but, good to have a date for the Earth bifurcation and dimensional shift. I've been preparing for being on either side of it, but in my heart I know I never belonged here.
I love all of you, even the mean ones. They are funny.
This explains the feelings resulting from the solar flares. I think they are like patches or updates to consciousness to prepare people. If you didn't feel anything, don't worry, seems most just felt emotionally up n down over the last few days, not thinking it was anything special.
1 astralfoto 2018-03-17
Damn you tryna match coz u smoking on GAS lmao
1 NotMySeventhAcct 2018-03-17
Fuck dude this has me dying lolol
1 ChinaXpat 2018-03-17
i dunno what that means, but I like it, no troll
1 NotMySeventhAcct 2018-03-17
I remember people saying the same thing in 2012/2013, almost word for word. Why would this be any different ?
1 ChinaXpat 2018-03-17
I dunno if I have any logical response, only my subjective experience and intuition, which can and have been wrong in the past. That said, they've also been right.
There does seem to be a lot of momentum building up on a lot of fronts towards a crescendo of sorts.
Personally, Ive been on a mission to wake as many people up as I can over the past few months, not really knowing why Im on the mission. Ive been rewarded with positive energy and increased intuition power. Sometimes people respond with vitrol and rage, but thats OK.
This feels good and right so Im gonna keep doing it no matter what friends and relatives say.
I recently read Dolores Cannon's The Three waves of Volunteers. It gave me a purpose I didnt even know was there. The book sheds a lot of light on the topic.
dunno what thats all worth.
1 ChinaXpat 2018-03-17
link to the book The Three Waves of Volunteers and the New Earth
https://dolorescannon.com/waves-volunteers-earth-generations-souls/
This book explains pretty much every aspect of the messages.
1 Opiumbrella33 2018-03-17
Look into dan winters. He talks a lot about how time is not what we think it is and that it actually moves backward so as we approach this catalyst whatever it is, people are starting to wake up and remember it happening before it does. He is a genius and I am not. My explanation sucks but search him out if you don't already know of him.
1 ChinaXpat 2018-03-17
holy shit. google is fucked up right now. i did a google search for dan winters and it came up with nothing. then i switched over to bing and there was a bunch of stuff on dan winters
this censorship is like being in china all over again
1 cassious64 2018-03-17
This building to a crescendo is something I've felt a lot since the new year started. I've had the constant feeling that something really good is coming, after years of shit (personally and it seems globally). I'm by no means psychic or anything, but occasionally I'll have repeat feelings/dreams that come true. I had dreams of my pet rabbit dying last year for 3 months before she died, and she wasn't sick or anything. I had the same feeling for three months after getting a new car that my tires would blow. 2 blew within a couple weeks of each other. It's just odd small things like that usually.
1 originalbL1X 2018-03-17
Interesting, I had an emotionally awful day and I don't know why. Straight rage. I started coming down sunset. Was there a post about it?
1 ChinaXpat 2018-03-17
yeah, my day got a lot better around 5pm, not too far off sunset. I was expecting this kind of thing from my experience since last flare, but today was pretty crazy. I even meditated twice and took a 3 hour nap. still had crazy feelings.
I posted something in the conspiracy sub before the flare happened. not sure its on the same wavelength as this sub though.
https://www.reddit.com/r/conspiracy/comments/849daf/solar_flare_tomorrow_ride_the_energy_if_you_know/?utm_source=reddit-android
1 originalbL1X 2018-03-17
Thanks. Nah, r/conspiracy is one of my favorites. By far, the most entertaining and enthralling subs on Reddit. When there's a good post anyway. Yeah, today was intense and I'm always pretty chill. Thanks for the link
1 ChinaXpat 2018-03-17
oh, thought your comment was in /r/psychic for some reason. There is a similar post going on there too.
1 AutoModerator 2018-03-17
While not required, you are requested to use the NP (No Participation) domain of reddit when crossposting. This helps to protect both your account, and the accounts of other users, from administrative shadowbans. The NP domain can be accessed by replacing the "www" in your reddit link with "np".
I am a bot, and this action was performed automatically. Please contact the moderators of this subreddit if you have any questions or concerns.
1 MrLariato 2018-03-17
Hey! So this is an ARG? one of those investigation games, I mean. I'm not very familiar with those.
1 LordPharqwad 2018-03-17
Ya I was wondering that to I dont know if that account is that posted all that nonsense about it being an ARG is even related to the original 370 voicemail or just someone using the voicemail trying to get attention to their twitter ? Idunno
1 noseris 2018-03-17
Ty just tweeted again. Says he simply deactivated his account so he wasn’t harassed.
1 [deleted] 2018-03-17
[removed]
1 ChinaXpat 2018-03-17
This post is now my all-time favorite on reddit. Thanks OP!!!
1 SmokinDroRogan 2018-03-17
Hijj/cicada3311 is by no means affiliated with the real cicada. Cicada has never acted like this before, writes much more coherently and intelligently, and would never use basic ass codes. Not sure what the voicemail is really about, but the rest of the stuff has killed it for me. The other stuff is so obviously bullshit that it takes away from the actual, initial event, and hurts the legitimacy of real conspiracies.
1 SailorDak 2018-03-17
I honestly feel that that the plane and cicada are entirely unrelated. That is my intuition. On the other hand, something about that 4/18/18
1 Arszilla 2018-03-17
We believe that Hijj/Cicada was a troll. Real Cicada gives a PGP key before their shit starts. These people didn’t and even opened DMs.
This was provably a troll or something trying to slow the progress down
1 NateDrake1234 2018-03-17
I think Hijj was trying to warn people and Cicada telling that its a game is a coverup for the warnings.
1 Bosh119 2018-03-17
So whats the go here? Is this real or an ARG?
1 notraven 2018-03-17
The original message seems real, digging around i found that a few unrelated other people had apparently received the same voiced message.
This twitter account stuff seems fake though. The messages have been getting less believable with each one, and looks like whoever was behind the twitter accounts seems to have run out of ideas, since we're now down to simple number -> letter conversions. Not to mention they opened up their DMs at one point to answer questions privately, that was a dead giveaway for me.
1 LuluGreening 2018-03-17
I just posted this in another thread but I'm relatively certain that the coordinates line up with the area the Singapore national service goes to train, like there are army camps there.
1 GreaterthangoodPuss 2018-03-17
Wtf, Google cicada 3301. This is a group who puts puzzles and alternate universe scinareos. Bro, this is a game, to recruit codebreakers and linguistics, just do some research about their previous contests.
1 swankyjerboa 2018-03-17
Do we have any idea of what is supposedly going to take place on April 18?
1 TheAlbinoRhinoWins 2018-03-17
If you Google anything concerning April 18th 2018 conspiracy, nothing of relevance is returned. I mean nothing. 3 video links from YouTube pop up on the mobile version of chrome and none of them concern anything. Everything that was a search result was plant conspiracy or other items unrelated. Really makes me wonder what is being censored. I for one hate that I'm told what I can and can't find out from the internet
1 Opiumbrella33 2018-03-17
There is also a man that is a preacher claiming that April 18 will be the rapture due to what xstain mythology says.
http://kbwealth4u.com/rapture.htm
1 LordLui96 2018-03-17
So I am new to this, but I first saw this on Facebook. Somebody compiled some of the stuff already and as I started to read it, my app crashed. So immediately thought let’s see if it’s on the conspiracy sub. I then found the mega, and halfway reading, my app crashed again. This is rather strange. It’s too well thought out imo.
1 hardness88 2018-03-17
Considering no one else is having that issue, it's safe to say it's your phone.
1 bunnyidiot 2018-03-17
My app crashed too wtf
1 Cloudtentacles 2018-03-17
i had this issue AND it logged me out of my account. five times.
1 TinyTobbert 2018-03-17
If something happens on April 18th, I love you all and I'm glad I got to Reddit with every single one of you.
1 ScaredycatMatt 2018-03-17
At this point in my life, I kinda just want something to happen. Whether it affects me negatively or not. I just want validation that something else is out there.
1 Zaptagious 2018-03-17
Me too mate
1 stevenbarcynski 2018-03-17
Love you
1 GrettP 2018-03-17
Same. I've spent so much of my life wanting to believe in ETs and UFOs, that even I started to think I was crazy. But if there really is something out there... I don't know. I really don't know.
1 Dunczah 2018-03-17
I think to believe that we are the only species to inhabit a planet is extremely close minded. I don't have anything against people who believe that but even if nothing ever show itself and we never know, I believe its more probable than improbable.
1 stevenbarcynski 2018-03-17
Love you
1 stevenbarcynski 2018-03-17
Love you
1 Kingbeesh561 2018-03-17
I think.. I can actually agree and disagree without any remorse? We've been teased and had conspiracies and things hidden or faked to us.. I want to know whether we're headed into the apocalypse or the super high tech future.. I think we all want validation if there is something out there.. but for now we wait..
1 stevenbarcynski 2018-03-17
Love you
1 stevenbarcynski 2018-03-17
Love you
1 Hectag 2018-03-17
The meteor hits tilted towers on April 18th.
1 OscarDeLaCholla 2018-03-17
Just a reminder...one more day!
1 MemeIord_ 2018-03-17
You can come out of the bomb shelter, we're all safe now.
1 Blackbaby11 2018-03-17
https://docs.google.com/presentation/d/1l8zrTP2FyNOfr5Yc_NpErSwipDBDnu1vaexVdiYwyiA/edit?usp=drivesdk
1 eezybreezybleezy 2018-03-17
I’m dumb can you explain this too me?
1 Blackbaby11 2018-03-17
Yeah sorry did this super late at night. Here is the website where i got this from. https://steemit.com/cicada3301/@defango/3-14-day-update-1711141131131-xyz-or-cicada-3301-2018-live-solving The link i originally provided is a series of slides showing his progress thus far.
1 internprimas 2018-03-17
Seems like an ARG or some type of Viral Marketing scheme. But for what maybe it's a social experiment? I've recalled hearing this on a semi national talkshow. Possibly it's a mass marketing scheme for a new game? I've found out there was clever marketers that did similar strange videos and tweets but it was for a new movie or TV show. I forget what the movie or TV show was about I believe it was for a new movie. The. Video started off like a typical clogger showing how to do something I believe applying make-up or doing a review. And something strange happened and let's just not get into graphic details. Obviously was a strange advertising. Because YouTube would've removed such a video. But it was talked about on various vlog compilations. Maybe this is a marketing ploy or an ARG?
1 jeffroyo 2018-03-17
The original voicemail and info was interesting, but once that cicada twitter account got involved and started tweeting cheesy 10th grade codes it became as obvious larp.
1 Ruffrider691 2018-03-17
IDK now people are getting Amber Alert messages with weird codes
1 shaylan_emilee 2018-03-17
Can you provide a link?
1 TrollopStrumpet 2018-03-17
Has anyone called and left a message at the phone number in the County Bluff Fishbowl video?
https://youtu.be/wVI6hlwzWIg
1 Arszilla 2018-03-17
Its Hex Code.
Translates to
The post will be updated in the upcoming hours. Woke up a bit ago, trying to handle the messages I got. Got over 300 over my sleep. I also got a cryptic message in my inbox.
1 TrollopStrumpet 2018-03-17
No, I mean call the phone # 406-298-5948.
Now there's a message... Sierra Oscar Sierra The Coordinates are posted.
I see others have tracked it down to a Kentucky Fried Chicken in Salt Lake City.
1 Arszilla 2018-03-17
Where was this phone number from? County Bluff?
1 TrollopStrumpet 2018-03-17
Yeah, in the Fishbowl video. It's a Montana phone #. But the sign is for Harman's restaurant, a KFC in SLC, UT. The phone # has that recording, call it!
1 SteamPoweredDonut 2018-03-17
I called that phone number 13 minutes after that video was posted in the early morning. It went to a voicemail box with the same voice from the Twitter Voicemail. I freaked out and hung up. 6 minutes later it called me back and I didn't answer, hoping for a voicemail. It didn't leave one, meaning there was probably a person on the other end.
1 TrollopStrumpet 2018-03-17
When I called it, I blocked my number.... haha! Guess I was paranoid too. I can see how it was scary to get a call back from the number in the middle of the night.
Looking more at the County Bluff videos, I think this person is in Utah. Bluff, Utah.
1 smardalek 2018-03-17
I wish so bad this was real tbh
1 cortecca113 2018-03-17
3 15 19 13 9 3 12 9 2 5 18 1 20 9 15 14 19 15 15 14
1 Arszilla 2018-03-17
1 Imhereforthepeople 2018-03-17
Cosmic liberation soon.
1 cortecca113 2018-03-17
1 12 12 23 9 12 12 2 5 20 1 21 7 8 20 20 8 5 23 1 25 15 6 20 8 5 16 12 5 1 4 9 5 19
1 Arszilla 2018-03-17
1 Imhereforthepeople 2018-03-17
This is getting creepy. I was thinking maybe there was a connection to the Pleiades meteor shower earlier today. Coincidence maybe?
1 FinneganRinnegan 2018-03-17
Well seriously, this screams Portal 3 or (possibly) Half-Life 3 related to me. Aperture Science? I have no idea what is going on, but some of this surely smells like a Valve ARG.
Maybe all the co-ordinates are related to the Borealis ship in Half-Life 2: Episode Two?
Who knows, but some of it is pretty interesting anyway.
1 artrojort 2018-03-17
This whole story is getting quite strange. I know ARGs tend to be all vague and creepy but some of the recaps included in this mega-thread like the County Buff videos and the bunch of Cicada tweets are giving off a explicit horror vibe, or a vibe I don't feel Valve has ever implemented in their marketing campaigns. Also the theme seems to be all over the place and sometimes too unprofessional.
This could however be a case of some randoms trying to cash in on the event, producing their own 'clues' that end up deviating us from the main ARG.
But I must admit that that website indeed screams Portal/Half Life. And interestingly enough it was just a couple of weeks ago that Gaben commented that they would start shipping games again, whatever that means.
1 mwaller94 2018-03-17
I can't get that website to pull up either.
1 cortecca113 2018-03-17
16 12 5 1 4 9 1 14 19 1 18 5 8 5 18 5
1 Arszilla 2018-03-17
1 cortecca113 2018-03-17
4 15 14 15 20 20 18 21 19 20 1 19 8 20 1 18 19 8 5 18 1 14
1 Arszilla 2018-03-17
1 AlternativeTentacle 2018-03-17
THE NEW DEATHH GRIPS ALBUM IS GONNA BE FUCKING AWESOME. STAY NOIDED
1 frightenedbabiespoo 2018-03-17
BUBBLEGUM BURIED IN THE JUNGLE
1 r1jjru5e 2018-03-17
Some guy / guys have decoded this quite a lot: https://steemit.com/cicada3301/@j1337/pi-day-cicada-3301-1711141131131-xyz-update-early-3-14-decoding
Really really interesting stuff.
1 cortecca113 2018-03-17
25 15 21 18 22 9 2 18 1 20 9 15 14 1 12 6 18 5 17 21 5 14 3 25 15 14 20 8 9 19 16 12 1 14 5 20 8 1 19 18 9 19 5 14 25 15 21 1 18 5 5 14 20 5 18 9 14 7 20 8 5 20 8
1 Arszilla 2018-03-17
The th?
1 cortecca113 2018-03-17
19 15 15 14 25 15 21 23 9 12 12 11 14 15 23 20 8 5 14 1 20 21 18 5 15 6 20 8 9 19 18 5 1 12 9 20 25
1 Arszilla 2018-03-17
1 cortecca113 2018-03-17
4 15 14 15 20 6 5 1 18 20 8 5 3 15 19 13 9 3 23 1 22 5
1 Arszilla 2018-03-17
1 Canadianstoned 2018-03-17
https://youtu.be/x2RMqViKohg
What are the chances the island has something to do with this?
1 aidy35 2018-03-17
They’re was a guy on here earlier that said about a Twitter account that was on about the moon and sheep but thought it wasn’t relevant, I can’t seem to find it but if you go to that account theirs a picture of woods/ branches in a Forrest well that looks exactly like the same place in the youtube video antlers in that weird YouTube channel I forget the name cloudy something I’ll edit if I get the name again
1 cortecca113 2018-03-17
5 14 4 20 18 1 14 19 13 9 19 19 9 15 14
1 Arszilla 2018-03-17
1 Shmukatelli 2018-03-17
So what’s the point
1 SyNtHeTiC_cHiCkEn_NZ 2018-03-17
Sounds like a ARG to me, or a hype up of a movie/event. Or, what really struck me with all the coding and things, maybe a prospective company looking for clever people EG-The people who solve the clues and codes, seeking valuable employees. Just my opinion considering the OP on insta/twitter said it was fake about the voicemail
1 Shmukatelli 2018-03-17
Makes sense, but don’t you think using the missing Malaysian fight would be really inappropriate?
1 SyNtHeTiC_cHiCkEn_NZ 2018-03-17
Thats what makes me think its a government agency more than anything. The only people to get away with touching on something like this. Just screams FBI/NSA recruitment drive to me.
1 Ruffrider691 2018-03-17
This is a fucking deep rabbit hole.....
1 bulbasuer 2018-03-17
Twitter user @cicada3311 made his name this code: 34342e3234343136372c20372e373639343434, when we put this code in hex to text converter we get coordinates again: 44°14'39.0"N 7°46'10.0"E When we look this up on Bing maps we get this giant bunny laying there: https://imgur.com/a/93pWb
1 Arszilla 2018-03-17
http://www.italianways.com/the-pink-rabbit-in-colletto-fava/
Its the pink 'rabbit'
1 ItsJustGizmo 2018-03-17
I’ve spent my morning reading this post. My minds twisted.
Not for how most people may think though. I’ve always wondered why historically, earthlings had “God’s”, each region of the world, throughout history. Eventually, they vanished off. Growing up I always wondered what if they were real beings, better than basic humans, and progressed humanity, like an adult with its child.. they were idolised, and then they weren’t here anymore.
I do believe there’s other life forms somewhere out there. Why? Maybe it’s those fantastic beings that helped us? Why not?
Fuck knows, anyway. It’s bleak to think that our world leaders wouldn’t tell us about external life and its arrival en mass. That part truly saddens me.
1 TopperMadeline 2018-03-17
My guess is, if aliens really do exist, that governing officials don't want the public to go into a hysteric frenzy.
1 ItsJustGizmo 2018-03-17
This right here is the most believable of all statements.
Though, after the news we have had with big Trump over the past year, nothing would surprise us anymore.
1 SyNtHeTiC_cHiCkEn_NZ 2018-03-17
Im convinced its the FBI/NSA's way to recruit smart people for their teams. They know the direct recruitment method is shit and doesnt get many people especially people very tech savy. People who are clever enough to crack these codes are generally smart enough to not to work for the FBI etc, this seems like a little game they play to entice smart people in.
1 edgebigfan 2018-03-17
A friend made a video explaining this situation
1 Arszilla 2018-03-17
I saw it but it is not well made if you ask me. See the stuff I shared on the thread vs what he covered
1 Gooch_suplex 2018-03-17
So, is there anything to worry about it?
1 notraven 2018-03-17
Don't think so. The original message seems legit, seeing as other people received it too (AMBER seems to have been bugging out at the same time as well, so maybe something was up with comms at the time which caused the message to be sent to another device?).
I think we can agree that basically everything else around it is fake. The twitter accs dropped the ball with more and more contrived messages, threats and even opening DMs (an obvious red flag for me).
Then some accounts started posting the same kind of encrypted messages right here in this tread? Yeah, we're getting played.
1 Gooch_suplex 2018-03-17
Puts me at ease, thanks.
1 SyNtHeTiC_cHiCkEn_NZ 2018-03-17
Is there a teamspeak or discord server people are talking about this at all? Im going hard out on this
1 Arszilla 2018-03-17
discord.gg/8M6Ky8t
1 SyNtHeTiC_cHiCkEn_NZ 2018-03-17
Thank You!
1 SyNtHeTiC_cHiCkEn_NZ 2018-03-17
It isnt coming up with anything in the discord, is it private or invite only?
1 Arszilla 2018-03-17
https://discord.gg/8M6Ky8t
1 vanaldren 2018-03-17
April 18, 2018 4.18 pm HayWired scenario
https://outsmartdisaster.com/be-informed/the-haywired-reports/
"The first volume in the HayWired scenario describes the hazards during and after the hypothetical M 7.0 earthquake hits the Bay Area on April 18, 2018 at 4:18PM PST. "
https://oaklandgeology.wordpress.com/2017/07/03/haywired-an-imaginary-earthquake-coming-in-2018/
https://catalog.data.gov/dataset/liquefaction-potential-as-a-result-of-haywired-earthquake-scenario-mainshock-april-18-2018-shak
https://pubs.er.usgs.gov/publication/sir20175013v1
1 Nootan_Best 2018-03-17
u/thecomingofthegeeks
1 DarkFireRogue 2018-03-17
Smells kinda hoaxy. I'll keep looking anyway.
1 Zaptagious 2018-03-17
FYI: The Pleidians is a supposed extra terrestrial race that looks like scandinavian humans (aka Norths). Ashtar is also an ET race/federation which supposedly hijacked a TV broadcast in 1977 with a warning message.
https://en.m.wikipedia.org/wiki/Southern_Television_broadcast_interruption
1 HelperBot_ 2018-03-17
Non-Mobile link: https://en.wikipedia.org/wiki/Southern_Television_broadcast_interruption
HelperBot v1.1 /r/HelperBot_ I am a bot. Please message /u/swim1929 with any feedback and/or hate. Counter: 161138
1 iamking1111 2018-03-17
I asked for disclosure on Thursday morning. Looks like we might get it.
1 MisanthropicaaAA 2018-03-17
Hey guys I've been lurking and excitedly reading info about this for the last two days. I just thought of something today though.
To support a possible solar flare/black box theory or something along the lines is maybe the voicemail wasn't just randomly chosen and sent to random people in the US. What if it really did emit data to South China and interfered with some part of Apple? The Ty guy has an iPhone. We would just need to know if the other people claiming to get the message have iPhone's too. Because Apple is in China perhaps the interferences happened along something internally in China and happened to leak into certain user's phones?
I want to be a skeptic so bad and claim BS. However this is way too sensitive of a topic for any company to risk making light of the Malaysian Airline crash. Honestly not worth the tasteless controversty where mourning families have no closure still. However I think the extra twitter accounts aren't related. I'm personally still doing some digging onnthe voicemail itself.
1 violetsylph 2018-03-17
What happened to the guy with the voicemail? This cicada crap is unrelated
1 Arszilla 2018-03-17
We are discussing it over Discord.
1 violetsylph 2018-03-17
Can I see?
1 Arszilla 2018-03-17
The discord link is here, scroll a bit down the “UPDATES” part of the megathread
1 sleepyowly 2018-03-17
Do you think this could be a form of spy communication? For instance, what if Ty's cellphone was a proxy or remote phone? is that possible? as if his phone was being monitored from another place as a proxy? then, all the cicada stuff is to throw people off? Maybe also, 41818 could be the time of a meetup or a transmission of information between sources? like a meetup of some sort. idk but it creeps me out in an exciting way
1 Parnivore_777 2018-03-17
Country Bluff posted video titled “Fish Bowl” @ 2am (Central) with the phone number: (406)298-5948 in the video. It is a Columbus, MT number and it rings through to an automated message that says “The corodinates are posted.”
1 Ninjapop159 2018-03-17
This may just be a coincidence, but the flight was headed somewhat towards Andaman islands, which are known for not being connected to the outside world.
1 Partyhelmet 2018-03-17
This is the exact plot to The Forest
1 47dniweR 2018-03-17
I'm sure this has been posted, but I haven't seen it. The picture of the rabbit from the rabbit/moon video, is from a book called "Goodnight Moon".
https://youtu.be/9yu_g5x3ZoQ
1 ziaf22 2018-03-17
Ok 4 hours ago they became real active posting tweets like every other minute
1 Tomyoker 2018-03-17
With our reading every line can I get a quick summery of what the end game for this
1 Rizrd 2018-03-17
So, is this legit or not? bcuz honestly i'm fucking scared reading the decrypted messages
1 ItsaMeMacks 2018-03-17
It seems that the general consensus is that its some form of elaborate LARP or ARG. Either way, Im fucking down for alien life being real in any case. If this is how I go, what a way it will be
1 cory26726 2018-03-17
Has anyone else noticed that someone hijacked the original twitter handle?
https://imgur.com/a/kyIpx
1 Arszilla 2018-03-17
Thanks for this info! Will be added ASAP. /r/Solving41818
1 datGuyChaddington 2018-03-17
Ty is now at: https://twitter.com/HOMOC1DE
1 cory26726 2018-03-17
Both accounts were created October 2014...
https://imgur.com/a/J0HdZ
1 YourFatZebra 2018-03-17
That is weird. I wonder what the connection between that is, if there even is one.
1 sleepwalken 2018-03-17
I'm new. What's a cicada?
1 ayyyee9 2018-03-17
The coordinates the reddit user sent for the mountain in California, is Mount Shasta. The theory is that ancient beings live under it in what is called Telos. There have been ufo sightings and strange disappearances on that mountain. I have been listening to David Paulides missing 411 which deals with strange disappearances in the national forest and the mountains. What if those strange disappearances are connected to this?
1 Medicatedjesusr6 2018-03-17
I live in mt Shasta there are very very rich cult people named “I am”ers. They think they are God’s and believe in beings called lumerians, people think the mountain is a portal connected to different mountains across the planet. There is also a conspiracy of a secret treasure in some passage ways under dunsmuir and mt Shasta ca. Also always found it weird we have a National armory here as well. Thinking about making an adventure to exact coordinate
1 Aurora_Darg 2018-03-17
So is this Cicada doing a test?? That's all I understood
1 Arszilla 2018-03-17
C3311 did not post a PGP. So not really.
1 Aurora_Darg 2018-03-17
Then I think it's probably just a big joke. I mean, the "test" is easy enough for very random users to decipher only using Google and very basic maths...
1 BrownieSundown 2018-03-17
What do you mean it is officially a cicada puzzle? I'm lost here.
1 Arszilla 2018-03-17
It isnt but it claims to be cicada. Cicada is an organization. Infamous. Posts really easy to hard puzzles for something. They give a PGP to verify that its them that are posting these and not a mimic. C3311 did not post a PGP.
1 TrentHard 2018-03-17
THEY FOUND THE FREAKING PLANE! http://www.news.com.au/travel/travel-updates/incidents/mh370-found-with-bullet-holes/news-story/b10b62c470ca319343c29062e8029cbe
1 Arszilla 2018-03-17
Same story. Its been reposted 3-4 times now. We don’t believe it.
1 TrentHard 2018-03-17
In some ways it would make sense though, especially with this information coming up. the more people focus on it, the more they find out. Finding the plane would diffuse some of the thoughts behind it and take attention from it. And it is no coincidence that they would find it less than 5 days after the OP received that voicemail and started all of this.
1 ThisIsAMisteakSauce 2018-03-17
It may seem “fake” but it was enough for China Australia and Japan to put boats in the water!
1 TrentHard 2018-03-17
Plus, how would they be able to know that there were bullet holes otherwise?
1 ScheisseBauen 2018-03-17
One of those coordinates is near where I live 0-0 I don't believe any of this stuff to be true, but that definitely caught me off guard.
1 Jethr0Paladin 2018-03-17
I googled Ashtar Sheran, seems to refer to the humanlike aliens people claim to have met from Venus.
Valiant Thor was from Venus, wasn't he?
1 SpoiledMilkMotel 2018-03-17
its death grips
1 RomireOnline 2018-03-17
Jeezus christ im spooked atm!
need to hide!
1 RedPill0829 2018-03-17
If this is real, then ig we finna be bowing down to lunar rabbits lmao
1 sjh919 2018-03-17
ABC News link no longer works...
1 Arszilla 2018-03-17
Will change it/add alternstive sources
Thanks for letting me know
1 WithinTheHour 2018-03-17
The original voicemail was creepy and intriguing, then it quickly jumped the shark with the coded messages and stuff. Get a grip guys.
1 ThisIsAMisteakSauce 2018-03-17
There was a picture you posted of a decoded string that was an island. I’ve been scrolling and couldn’t find it but the first thing it brought to my mind is North Sentinal island that is home to the last people group on earth that is truly cut off from the outside world. It is illegal to travel to the island. Not sure if that means anything but for anyone thinking that this is Biblical then it could make sense because the Gospel has obviously not been shared with them and that matters if the were to be at hand.
1 patg9234 2018-03-17
ARG for Cloverfield. You're welcome.
1 exxcessivve 2018-03-17
Didn't that already come out though?
1 Tigershark2112 2018-03-17
OP is wrong, but there is indeed a 4th Cloverfield coming this year.
1 exxcessivve 2018-03-17
Ahh okay
1 letja01 2018-03-17
So here's my take on this, meshed with my years of interest in trying to integrate Christian mythology, the enlightenment of the mind, ET events, and now this mystery itself. This is speculative, but certain things come to mind when I go over it all that don't seem to have been proposed yet.
The cicada can represent a number of things, from plagues and destruction to the subjective nature of the human mind (like Rorschach blots, we see what we believe and what on some level we choose to see). Some cicadas also spend much of their lives buried underground, and emerge all at once. In some of the messages we've gotten, there's allusion to this - something about buried or stay buried. There's also been talk of waking up, and opening the mind's eye.
There are clearly ties to Revelations prophecies, with talk of end times and Canaanites, raining fire, earthquakes, "seeing the signs", etc. Plagues are supposed to accompany those end times; another tie to the cicada.
Haha, I should mention I can hear some sort of cicada outside right now. Just for flavor ;-)
Concerning ETs, many believe that if a true Rapture were to occur, an ET removal of humans would fit the bill. When I think about the proposition (forget the name of it, but I don't think it's Fermi's paradox) that a sufficiently technologically advanced society would ultimately destroy itself, if at all violent, and that's why we don't see alien societies contacting us; it doesn't make me think that every civilization must destroy itself, but rather that the very few that don't destroy themselves must therefore be beneficent, and would contact us with the intention to help humanity. Were that an intention, it would have to be gone about very carefully, as so often the road to Hell is paved with good intentions. Think Prime Directive. When the time is appropriate, they would act. This fits with the narrative we're being given by Cicada/Hijj.
Concerning the actual Fermi paradox, it assumes that an alien race would desire to be known to us. I personally think there is a lot of evidence to support that they have been here before, in the ancient past, and perhaps even still now. But where?
Back to Christian mythology. Revelations describes the end times as being dominated by not one, but two Beasts: one that comes out of the seas, and one out of the land. Sounds a little like the cicada mythos (keep in mind what they mean, not necessarily actual cicadas), but what about the seas? Well, all this initial activity was concerning MH370 and the seas around. Coordinates pointing all around the area, strange thermal signatures above and below what appears to be an aircraft, all sorts of info pointing to that region of the world. Some have suggested that Malaysia/Indonesia/that area may have once been the continent of Atlantis. If you accept the proposition that ETs have been here in the distant past, and consider the strange bits of information we've gotten from Cicada et al about DNA sequences and "secrets", it makes me wonder if there was some kind of genetic engineering going on in our distant past. Atlantis sinks due to ever shifting tectonics around the world, and who-knows-what goes down with it. Something or things genetically manipulated to survive an aquatic life, or safely encapsulated under the islands? A source for the Beast from the seas?
But still more needs consideration. Namely the nature of time. First and foremost, it doesn't exist. We put a ruler up to the goings-on and linearize it, and call that time. But energy just flows and interacts with itself, playing out like ever-resetting dominoes. That seems to destroy free will, but it does not. What destroys free will is how we think of ourselves, as finite beings stuck in this skin. From that perspective, everything seems to be happening to us, rather than us being the universe and "universing". In the latter perspective, our true self has infinite power and free will. I think something like this is what Cicada/Hijj is getting at when telling us to open the mind's eye (third eye), and adds some sense to the cryptic messages that they are not us but they are us. That message could also support the idea of genetic manipulation and integration.
In my gut I feel that all of this is very important, but only some if it is truth. If the Christian mythology is to be heeded, then misdirection and deception is a staple part of the end times. I think some of this is deception. We've been warned now to not trust Ashtar Sheran, and the sudden departure from the MH370 info is fishy. Also, we all remember some years ago when China was building those islands, there was a pretty big rhetorical resistance to it from many nations, but now there's no talk at all about it, as if it's fine after all. And yet there are surface to air missiles set up. Trump's Space Force announcement hasn't gotten much attention beyond ridicule, but together with the upcoming new moon/SpaceX launch and our instruction to "watch the waxing satellite", it suggests there may be something to defend against soon. Could it be Ashtar? Or the Pleiadeans? Is one or the other deceiving us? Speculation, yes, but arrows seem to be starting to align.
Now, more about time. I liked someone's likening MH370 to the Philadelphia experiment, because that catastrophe suggests transposition with respect to time, but think of time more like space. We can move around in space but we always say we're "here". Time, for what it is, is more like that. It's always "now", but that now changes in its feel and its nuance. Just like we think we can measure space with a ruler, we think we can measure time with calendars and clocks, but we aren't really measuring those things, useful as our conventions are. The hash marks are on the balancing arm, not the scale pan. We can only compare what we know to what else we know, but we aren't getting to the core nature of what we're trying to measure. We can't. That's why no matter how far into the atom we gaze, things always seem to get smaller and elude our measurements. Similar when we look big.
Perhaps something happened on or around MH370 that involved transposition in time, which is space. Hence Cicada/Hijj (keep forgetting who provided which bits) referring to the Assassin's Creed games where through use of our minds and DNA we re-experience the past, which then informs the present paradoxically. It normally works the other way around, the present creates the past, like the wake of a ship. Interesting, too, that that game series had central to it a devastating solar flare, and this all started during a solar flare. Hawking's passing was perfectly timed; in fact, I wonder if his passing was a necessary step.
So to make a gamble on a theory of all of this, I'm open to the possibility of an imminent alien Rapture, immediately followed by whomsoever is deceiving us. The cicada-inspired Beast then awakens/arises, followed by the whatever from the seas. I think the key to getting through all this is, indeed, opening the mind's eye, and realizing our true nature. I think we're ultimately far more powerful and expansive than we've been taught to believe. Hoax repeated becomes fact, or something.
That was long. Hope it adds something insightful.
1 Isharc 2018-03-17
Also, this year, April 18, coincides with the festival of 'Akshaya Tritiya' according to the Vedic and Upanishads' scriptures. Akshaya Tritiya is the day when the sixth incarnation of the Hindu God 'Vishnu' was born- 'Parshuram' He holds a parshu or an axe as his weapon of choice. It is believed that he killed /removed the tyrannical rulers from the world around 21 times. So, my take on this whole theory is that, humanity will either be rid off tyrannies, and usher into an age of peace and knowledge.
1 Isharc 2018-03-17
Or, humanity will come into contact with an ET species.
Also, it could be an ARG.
1 Opiumbrella33 2018-03-17
Somewhere in this all it said don't trust ashtar. I just realized that ashtar was the name of the alien collective that supposedly hijacked the itv signal and transmitted a message saying that we had a shoe time to learn to live in peace and that they are watching us.
Ashtar galactic command
1 Opiumbrella33 2018-03-17
Someplace it says don't trust ashtar. That was the name of the alien collective that hijacked an itv signal saying we had a short time to learn to live I peace and they were watching us. I tried posting this earlier but it said it didn't work so I'm doing it again.
1 jesus55681 2018-03-17
Hey guys so I was looking stuff up about this trying to see how the April 18 relates and I saw that Easter is on April 1 this year and the Holy Week ends on April 8. Maybe not on April 18 but April 1-8?
1 Arszilla 2018-03-17
Hmm
So April 1/April8 2018?
1 jesus55681 2018-03-17
Yes
1 barenakedcactus 2018-03-17
I have a feeling this is just a well thought out ARG
1 vlip711 2018-03-17
Im kinda new on reddit and about arg so whats the purpose of a arg and what are they? Like a game ? U can play like solving riddles?
1 questionthingz 2018-03-17
" 20.1.11.9.14.7 " i put into a search engine and got this as the first result http://www.generationword.com/maps.htm
1 Arszilla 2018-03-17
Page wont load. Picture?
1 questionthingz 2018-03-17
its a page of biblical maps, link seems to work for me
1 questionthingz 2018-03-17
44.244167, 7.769444 is where the giant stuffed bunny was http://www.pickchur.com/2013/12/google-maps-coordinates/
1 CV117 2018-03-17
Half Life 3 trailer no doubt
1 Arszilla 2018-03-17
2.3
1 pepisel 2018-03-17
My brain hurts
1 Mind_Infection 2018-03-17
I call bs on all the social media stuff. Prob some edgy kids trynna be creepy. Reminds of that Pokemon Creepypasta reality thing that Blametruth did some years ago
1 Tigershark2112 2018-03-17
Aaaaaannnnnnd everyone has now forgotten about this.
1 Arszilla 2018-03-17
No. We are at /r/solving41818 . Ran out of space to edit my selfpost here.
1 kittensandpizza 2018-03-17
I was looking for this specific thread while explaining the story to my husband and got a phone call from Lybia that was mute for a few seconds. Probably not related but creepy anyway.
1 poptartmenace 2018-03-17
Could we get a TL;DR lol
1 brenthonydantano 2018-03-17
Personally I find it particularly creepy when considering the second decryption of Sanborn's 'KRYPTOS':
"IT WAS TOTALLY INVISIBLE HOWS THAT POSSIBLE ? THEY USED THE EARTHS MAGNETIC FIELD X THE INFORMATION WAS GATHERED AND TRANSMITTED UNDERGRUUND TO AN UNKNOWN LOCATION X DOES LANGLEY KNOW ABOUT THIS ? THEY SHOULD ITS BURIED OUT THERE SOMEWHERE X WHO KNOWS THE EXACT LOCATION ? ONLY WW THIS WAS HIS LAST MESSAGE X THIRTY EIGHT DEGREES FIFTY SEVEN MINUTES SIX POINT FIVE SECONDS NORTH SEVENTY SEVEN DEGREES EIGHT MINUTES FORTY FOUR SECONDS WEST X LAYER TWO"
1 specodhec341 2018-03-17
http://www.dailymail.co.uk/news/article-2603075/Co-pilot-missing-flight-MH370-desperate-call-mobile-phone-AFTER-aircraft-lost-normal-communication-ground.html
Just found this. It might be interesting. The last attempt of phone call (co-pilot made it after plane went off the radar) is so freakin close to coordinates sent in the original phone message
Yet I recall the last GPS coordinates of flight MH370 were something west from Australia...
1 hurting4asquirting 2018-03-17
I just wanted to add an update of that thread, there’s a new conspiracy theory that they are trying to add to itcheck it out, it’s a whole thread.
1 LilBitdat 2018-03-17
I personally think that the flight MH370 was filled with VIPs going into D.U.M.B. sites or safe haven before the disastrous pole shift strikes in guised of either missing or death.
The coordinates that were shown might be locations of the safe haven sites.
Isn't it too much coincidental for Stephen Hawking to die during Pi Day and Einstein's birthday?
How come MJ died but his backmasked "This Is It" song says otherwise? About the Dave Dave after death interview that reeks with MJ's vibes/mannerism?
Fear & Ignorance is poison, while Love & Knowledge is air.
1 ipizi 2018-03-17
This is real. I know many will doubt, but I can 100% confirm the Plaedes part. Keep your cameras ready on the 18th.
1 Sainterr 2018-03-17
Great post. This includes probably everything about the situation. This was very interesting to read. Thanks i’m amazed
1 Arszilla 2018-03-17
THE POST HAS NOW MOVED TO /r/Solving41818
https://www.reddit.com/r/Solving41818/comments/85aj1b/the_twitter_voicemail_story_megathread/
REFER THERE FOR THE FUTURE UPDATES
1 AutoModerator 2018-03-17
While not required, you are requested to use the NP (No Participation) domain of reddit when crossposting. This helps to protect both your account, and the accounts of other users, from administrative shadowbans. The NP domain can be accessed by replacing the "www" in your reddit link with "np".
I am a bot, and this action was performed automatically. Please contact the moderators of this subreddit if you have any questions or concerns.
1 Lulzorr 2018-03-17
So what's with purging the discord and disabling all invite links?
Are you guys really that salty that a general chat involves general discussions?
This on top of the power move yesterday where you guys hid information in a "verified" chat makes you look really suspicious - Especially when you demonstrated the ability to make an announcements section where only admins could post but all users could view.
Sketchy as fuck.
1 Arszilla 2018-03-17
No. We will clean out some trolls and such.
Discord will return to normal state once its cleared
People doing the work complained of spam and clusterfuck chat. Verified chat is spam free. Progress is being made there.
I can and will disclose the chats if requested to @everyone but they won't be able to participate as that channel is meant for people who aren't trolling
Aside that we had these because of trolls and such
https://i.imgur.com/Zy4v5hM.png
https://i.imgur.com/N7EEaAV.png
https://i.imgur.com/3dOpZFX.png
1 Lulzorr 2018-03-17
Yeah, Those were the things you mentioned in general chat before. Sidestepping the actual problem of what you're doing.
You specifically made a "verified only" chat for the purpose of consolidating information and then made it private when in the first place it should have been publicly visible but only allowing the posts of users who were seen to be actually helping.
You don't see the hypocrisy at play here? You don't see why people should be asking questions?
You hide under the guise of trolls.
If you don't want spam in your general chat make a #off-topic channel. If you don't want spam in the resources/discovery channel, assign roles that can post there. I know you can do it because you have an #Announcements channel. You chose not to. Why's that, huh?
Oh, and https://i.imgur.com/faMy45d.png . https://i.imgur.com/BYbDlBD.png . I think the rat is you.
1 KayleighEU 2018-03-17
Dude do you have any idea how hard it is to maintain a cohesive chat about this one topic with people posting such trivial shite?
General chat is still general chat about the voicemail issue, dumbass.
Sincerely, Kaytality from the Discord. xox
1 Lulzorr 2018-03-17
Yes.
I also know exactly how easy it is to verify users under a set role and disallow regular members from posting in a separate chat. It's not even close to difficult.
And yet, I'm the dumbass. ... And you're proving me right by being oh so worried about a "mole" in your precious little hidden chat.
Information should be available to everyone seeking the truth, whatever that truth might be.
I hope the totalitarian "security roles" work for you idiots. How's that minute amount of power feel? Good?
1 KayleighEU 2018-03-17
It'll feel better when I weed you out, precious.
1 Lulzorr 2018-03-17
Gonna have to look harder than that, then.
Enjoy the power trip while it lasts. If this is how you guys want to run things it will die. Enjoy the dripfeed of unrelated, banal information.
1 KayleighEU 2018-03-17
We're actually getting some incredible new info as I speak, but I suppose you already know that, don't you?
1 Lulzorr 2018-03-17
What a shame, if only the general public had the chance to filter through the information as it appeared as a sort of thinktank.
1 Lulzorr 2018-03-17
Kicked and banned, huh? That's pretty rude of you. It's clear to anyone who was there that I was contributing to the discussion.
Feel powerful now?
1 KayleighEU 2018-03-17
It's much more relaxed without you.
1 Lulzorr 2018-03-17
I find it hard to believe that i caused any tension at all besides within you. The rest of the chat wasnt a massive cunt, for starters.
1 Arszilla 2018-03-17
Editing the timestams out? How low of you. And cut/edited my whole comment?
https://i.imgur.com/KCS9w08.png
https://i.imgur.com/V1fxNvr.png
I warned people to use #spam for unrelated stuff. I have nearly 3 channels per topic (Discussion-Media-Deciphering and some have Decoding)
Verified channel has the same shit going on as the other channels minus the spam. In the end all the data gets added on the Megathread, no info is kept away from anyone.
Trying to sort this out. If you have a way effective solution then say it in the chat. Hiding behind this reddit tag and spying/shitposting on reddit is no use. I am trying to get an effective taskforce to solve this.
I do not seek to punish anyone etc. And users that are to be purged are simply gonna kicked, not banned.
1 Lulzorr 2018-03-17
I did edit the time stamp out so that you can't figure out my timezone based on it. Easy concept.
Spam is filled to the brim with joins and leaves. Make an #off-topic channel or suffer the consequences of having a "general" chat. I.E. that it becomes off topic meme garbage. That's the internet now. Catch up.
You probably should have mentioned that in the first place. Instead you said it was only to combat spam. Also, who gets to decide what data is added? Who gets to decide who is verified and who is not? What is the qualification?
Would it not be simpler and easier to make it visible publicly but approved submitter only? Hmm.
I already gave you my extremely effective solution four or five times now. I am not hiding behind anything, This is the same username i use everywhere. Or is it?
Here's your one step solution: Don't hide information in the first place.
Make a verified chat section, Allow only approved Verified users to post.
Make the verified chat visible to all users (@everyone in the discord menu) but revoke posting privledges.
exactly like this.
Then make an #off-topic and moderate #general.
I still can't believe you guys are incapable of understanding the hypocrisy of hiding information. That might be the funniest part.
1 Lulzorr 2018-03-17
Explain my ban. I was contributing.
1 Arszilla 2018-03-17
I did not ban you. I’ll upload a pic of the audit log.
But you were constantly trolling/arguing with mods so they had the right to do so
Plus, you got an alt in the server, don’t cry :)
1 Lulzorr 2018-03-17
I absolutely was not trolling and I have no alt in the server.
I was contributing and discussing. Your own users asked Kay not to ban me.
1 Arszilla 2018-03-17
You could see #verifiedonly before it was public. Thats an obvious lie there.
You have an alt. Don’t deny it. We know.
1 Lulzorr 2018-03-17
Or maybe I have friends who are also interested in the situation? had that not occurred to you yet?
Here's evidence of your own mod being out to get me and the users requesting i not be banned:
https://i.imgur.com/KWrckAU.png
1 Solarium214124 2018-03-17
It's not wrong that we have some fun, we are doing work as well if all you can do is sit on your ass and bitch about me that's not my problem
Cheers -Solarium
1 RecoveringGrace 2018-03-17
Y'all need to quit clogging up the mod queue with your quarreling. Go fight elsewhere. Thank you.
1 Lulzorr 2018-03-17
I don't even know who the fuck you are but thanks for the unwarranted two cents. No one asked, no ones cares.
1 Lulzorr 2018-03-17
Personally, I think you're all just mad that I caused you to make the verified chat publicly viewable.
Here's my full PM discussion with Kaytality
You, and your mods, were only looking for a reason to ban me. No matter how small. Even with me contributing to the discussion, you still find fault with jokes.
You've shown your true colors twice now, first with the desire to hide information from the group and then again by holding a grudge when you're forced to share the information.
You'd even ban a valuable source of discussion just because you're mad. You're just salty. You and your mods want to flex their minuscule amount of power over the users you have. Probably because you're powerless in the first place.
Oh, And it should be mentioned the reason #general ended up off topic is because of you yourself. You broke the discussion by entering and making stupid remarks about revolt while I tried to tell everyone in #general that that was a bad idea, that making a new server would only cause dissent and division.
Me, The person you think was trolling, was trying to attempt to keep everyone together in the same place.
Yet because of your grudge you ban me. Very interesting, huh.
1 BrothersOfTheWorld 2018-03-17
Anyone else get a weird text message while reading up on this stuff?
1 Arszilla 2018-03-17
Not me.
1 BrothersOfTheWorld 2018-03-17
It's probably just spam, but I can share if you want.
1 Ionlyspeakformyself 2018-03-17
I want to see said message
1 BrothersOfTheWorld 2018-03-17
The link in the text message brought me to a spam post on Facebook. But I googled the email it was sent from and a bunch of stuff about space showed up. Just a weird coincedence I think haha
1 Arszilla 2018-03-17
Please do.
1 [deleted] 2018-03-17
[removed]
1 RecoveringGrace 2018-03-17
You cannot share email addresses here. It is doxxing and will amount to the entire sub being shut down.
1 BrothersOfTheWorld 2018-03-17
I'll remove immediately
1 RecoveringGrace 2018-03-17
Thank you.
1 BrothersOfTheWorld 2018-03-17
Is posting a screenshot with the email still breaking the rules?
1 RecoveringGrace 2018-03-17
You have to block out any names, addresses and phone numbers. Nothing personally identifiable. It is Reddit site-wide rules.
1 BrothersOfTheWorld 2018-03-17
Gotcha, thanks for the info.
1 RecoveringGrace 2018-03-17
No problem. Thank you.
1 aleister 2018-03-17
Best part, the link lead to malware.
1 RecoveringGrace 2018-03-17
What do you know? Hmmm..
1 aleister 2018-03-17
I clicked it and watched it redirect me through 2 sites and then it tried to execute a Flash exploit in my browser.
It's likely a one-off, and I'm not going through and clicking all these links, but folks should be away of the risk.
1 BrothersOfTheWorld 2018-03-17
My mistake, I'll remove that as well.
1 hay4bay 2018-03-17
I definitely got something weird this afternoon while I was at work. I read through this whole post last night. I don't think it's related, but it was weird nonetheless. I didn't click the link, because I don't want a virus or some shit but I got a screenshot. Weird text.
1 BrothersOfTheWorld 2018-03-17
.space was a part of the email that sent me a text too, interesting.
1 hay4bay 2018-03-17
What are the odds of that? I rarely get random texts like this on my phone. Calls? Sure. But rarely texts. Then I get this the day after reading all of this stuff and someone else gets a similar one? It seems a little odd to say the least. I wonder if anyone else got one too?
1 BrothersOfTheWorld 2018-03-17
I'm wondering the same thing, it's definitely weird. It's especially strange to get a text from an email. Guess we will have to wait and see!
1 hay4bay 2018-03-17
I'm not superstitious, but I am a little stitious! I honestly don't know what to think about it. I don't think it's much, but I'm not willing to click the link and find out, mostly because viruses you know. Maybe somebody else will take a chance?
1 BrothersOfTheWorld 2018-03-17
I clicked the link from an apple device and all it did was bring me to some fake Facebook giveaway. Mods said it was malware, nothing too malicious. The link doesn't seem to be anything, but the .space email is definitely something interesting.
1 hay4bay 2018-03-17
Glad to hear "it wasn't too malicious" ha. It must just be a lame coincidence? Am I reading into it too much?
1 BrothersOfTheWorld 2018-03-17
Possibly, I take all of these conspiracies with a grain of salt haha. Doesn't mean it isn't fun to speculate though!
1 Hrvatix 2018-03-17
I got an SMS from my phone carrier that says they would block mass spam messages coming to users, on the same day this audio was released. Strange...
1 Kopekemaster 2018-03-17
I think there is something interesting going on, specifically around the MH370 flight. However, I'm pretty sure like 90% of this is a combination of trolls and a quite sloppy ARG. Specifically, the stuff like: reversed audio; text put through a simple/commonly used code; generic "they're coming" kind of shit; hexadecimal and QR stuff; random lat/lon locations that point to "mysterious" places; that kind of thing. A lot of it is just stuff that literally anyone could do/make in five minutes for a bit of fun, and there's little to nothing connecting a lot of these things. I could call someone and leave a message with the original voice message if I wanted.
1 Anthillmob74 2018-03-17
I doubt it's even connected but putting it here...here in uk today hundreds of schools got hit with an email of American origin of a bomb threat. Disruption a cross the schools.
1 Arszilla 2018-03-17
www.bbc.co.uk/news/uk-43457548
Minecraft kiddo lmao?
1 Anthillmob74 2018-03-17
Thank you
1 SuperCaptainMan 2018-03-17
Infinity War marketing ARG
1 SHOPLIFTING_THROWAWA 2018-03-17
so is it fake
1 cassious64 2018-03-17
At risk of repeating others, I think the stuff with ty and the voicemail are legit. The rest seems to be trolling. I'm hoping more can come out about that.
1 Aquamarimus 2018-03-17
Where is blackpink comeback till world gonna end
1 ClovenFeet 2018-03-17
can confirm, iriga is a place in the PH. i am from there. pm me if you want me to do something
1 Arszilla 2018-03-17
It probably doesn’t have to do with there, I dont know.
There was this QR with a “skeleton hand”. An incomplete QR. When that tweet (6+6+6 iriga) was converted to a QR piece, it seemed to fit to that skeleton hand, finishing it partially. Too many images etc been shared in the past couple of days so I gotta find the QR, but it was shared in Discord
1 ClovenFeet 2018-03-17
notify me if something came up. I've been following this thread the past few days
1 ClovenFeet 2018-03-17
it'd be nice if this is just an elaborate ARG.
1 J-ToThe-R-O-C 2018-03-17
Intersting thing about the lunar rabbits. refer to kaguya-hime, of japanese mythology. "The bamboo leaves on her head resemble rabbit ears, furthering the moon motif, as the Japanese see a rabbit in the moon instead of a man."
And people fromt he moon have been a part of japanese folore and the orginis of the people themselves. it's even said one of these beings taught them hout to make katanas
1 delawareislife 2018-03-17
We have been decoding the videos for this all night decided videos and evidence of cern
1 delawareislife 2018-03-17
https://docs.google.com/document/d/1-Yg2vehTH-9apwgBg13uVTOcmUTcKB4RPOSSnju9P14/mobilebasic
1 Arszilla 2018-03-17
Hmm. Mentions my thread and other things we are covering in the sub and discord
How did yoy find this?
1 delawareislife 2018-03-17
We made this ourselves. We have a private group. We also discovered coded audio messages in the videos. We got "1336" and "we are coming" from the main stopswitch video.
1 Arszilla 2018-03-17
If you are in the Discord, please contact me. Easier to chat there. I got some stuff to ask if you don’t mind.
1 delawareislife 2018-03-17
But if you dm me illl send my fb
1 delawareislife 2018-03-17
The videos also have coded images too
1 Arszilla 2018-03-17
Which videos?
1 delawareislife 2018-03-17
Stopswitch and Colin of the internet (codes go back to 2015 sayin 41818)
1 XxMystiKxX 2018-03-17
Looks like the Tv Show "Person of Interest" :D
1 delawareislife 2018-03-17
Look into cern tests and dates. Dec 21st 2012.
1 delawareislife 2018-03-17
I'm not I can't use discord it boots me
1 Arszilla 2018-03-17
What do you mean it boots you? I don’t like using FB btw.
1 delawareislife 2018-03-17
Every time I try to open the discord my app shuts down completely I've been trying to get in all day. I was the first person to find a lot of these videos and start decoding. Check the ones from 2015 and check the comments. This is serious. All of this links to cern
1 XxMystiKxX 2018-03-17
Looks like the Tv Show "Person of Interest" :D
1 Arszilla 2018-03-17
Not really. Its basically “George Orwell” on a different aspect but this is different.
Sure the way Machine sent messages is “similiar” to the voicemail and is not. Hard to explain right now.
1 delawareislife 2018-03-17
http://waterfordwhispersnews.com/2018/01/16/sorry-but-we-accidentally-ended-the-world-in-2012-admits-cern-scientists/
1 Nascarfreak123 2018-03-17
You really believe that? Heck even posted it?
1 H0n3yb4dg3r69 2018-03-17
Lmfao hilarious onion type shit
1 delawareislife 2018-03-17
Say what you want but the dates for all this line up with cern. CERN did its biggest ever test on de 21 2012 that's not fake. The world ended then. That's why we have things like the Mandela effect and so much weird shit happening. We're in a holographic universe.
Look at CERN dates in relation to the theory. Translate the video codes from years back. This is way deeper than you think. I'm not a conspiracy nut. I'm trying to tell the truth here.... I am putting my life at risk.
https://www.southampton.ac.uk/news/2017/01/holographic-universe.page
https://www.symmetrymagazine.org/article/august-2013/holographic-universe-experiment-begins
https://www.google.com/amp/s/www.express.co.uk/news/world/565315/Scientists-at-Large-Hadron-Collider-hope-to-make-contact-with-PARALLEL-UNIVERSE-in-days/amp
1 hakiku 2018-03-17
r/atetheoniom
1 delawareislife 2018-03-17
https://www.google.com/amp/s/www.thesun.co.uk/tech/1358274/jaw-dropping-photos-taken-above-cerns-large-hadron-collider-lead-to-wild-new-conspiracy-theories-and-prove-portals-are-opening/amp/
1 delawareislife 2018-03-17
After everything I've found so far I fear for my safety. Please copy all you can from the google doc and email Timberlyn@gmail.com if I go dark that's the backup switch
1 Arszilla 2018-03-17
I cant right now. Can you post it on ghostbin etc and send me the link?
1 KAMarzus_ 2018-03-17
If you're using a VPN you should be Kushty :D
1 defango 2018-03-17
That Cicada 3301 2018 Document is not a Group Solving. That is my personal solving.
This ARG has nothing to do with the 3301 puzzles and seems to be a hoax of limited skillful creation.
Updated the name as proof. https://docs.google.com/presentation/d/1l8zrTP2FyNOfr5Yc_NpErSwipDBDnu1vaexVdiYwyiA/edit?usp=sharing
1 Arszilla 2018-03-17
Oh amazig work! I assumed a group solved it. Will fix it. Also /r/solving41818
1 KAMarzus_ 2018-03-17
https://www.thesun.co.uk/news/5839167/missing-flight-mh370-found-on-google-earth-riddled-with-bullet-holes-crash-investigation-expert-claims/ convenient timing is convenient
1 Arszilla 2018-03-17
Its from a radar image from 2009.
MH370 is not found
1 KAMarzus_ 2018-03-17
Is not not coincidental that media outlets are suddenly posting stuff like that saying that it has been found?
1 muskrat0110 2018-03-17
Could this be in any way related to the Austin Bombings? Some psycho making a sick game out of it, announci mg when his "big finale" could be? Probably not, since I don't see any real connection Austin atm, but something worth consideration.
1 Arszilla 2018-03-17
If you are on Discord I shared a major update in #discoveries-and-findings.
Check it out. Might explain it...
1 muskrat0110 2018-03-17
Alright thanks man. This is extremely interesting
1 caseyk3 2018-03-17
I can’t find the discord group. Help
1 KAMarzus_ 2018-03-17
How do I get into this discord? I have stuff to share.
1 Arszilla 2018-03-17
There is a discord link undernearth the #UPDATES subtitle.
1 nehigginbo 2018-03-17
Ashtar Sheran is a common UFO conspiracy name in regards to religions link to aliens right?
1 slp123123 2018-03-17
Guys, idk if anyone missed this but on the handwritten notes provided by the fifth morse code tweet: ._-.-....--..
the date in the top right corner of the first note has some ellipses and an arrow pointing towards it? so i googled the date and the only relevant-ish important event I found on that date was about the Achille Lauro Hijacking, when US fighter jets forced an Egyptian plane carrying the hijackers of an Italian ship "Achille Lauro" to land in Italy, where the gunmen were later placed in custody... I just find it out that theres this mention of an alternative location to the coordinates that were somewhere in Italy, and then again the mention of Pyramids being 'home' in another decoded tweet. Maybe this has some kind've link? Maybe the scnario in the case of MH370 was similar in which international forces had to get involved because of "hijackers'/extraterrestrials?
1 BlackFlagWraith 2018-03-17
Now here's one thing to point out. Everytime some catastrophic event (or similar) is announced or predicted the date is always in the near future. Because no one gives a fuck if you tell them the world's gonna end in 2043. Don't drink the koolaid folks.
1 gothboigbc 2018-03-17
i just need a ciggy to cope with it
1 itsfinn 2018-03-17
Don't trust Ashtar?
Easter?
1 Arszilla 2018-03-17
Ashtar is a cult. Google em. Cant help as I am on mobile
1 itsfinn 2018-03-17
Thanks for this thread OP.
Found a Wiki
Ashtar (sometimes called Ashtar Sheran) is the name given to an extraterrestrial being or group of beings which a number of people claim to have channeled. UFO contactee George Van Tassel was likely the first to claim to receive an Ashtar message, in 1952.[1][2][3][4] Since then many different claims about Ashtar have appeared in different contexts. The Ashtar movement is studied by academics as a prominent form of UFO religion.
1 NeverNeverSometimes 2018-03-17
Nato phonetic alphabet is meant to eliminate confusion when relaying things like license plates or names, not to send coded messages. "They're so advanced and they're watching my communications... better send the simplest coded message that even a kindergartner could figure out. I'm sure that will trick them" Seriously, pig latin is a more complex than that.
1 Arszilla 2018-03-17
Lmao this.
Someone understood me.
I did not write this as I was basically trying to transfer the news without/with minimal commentary.
1 ConsumeAdderall 2018-03-17
The add onion comment gives it away. When fans were convinced that the Beatles had hidden content/context in their lyrics, Lennon wrote glass onion, a song full of little riddles and red herring shit, just to stir the pot.
1 HotFightingHistory 2018-03-17
I love these. I remember how freaked out Webdriver.Torso had me, then I saw the rick roll post by their account and LOLd quite heartily. I have to say I was glad it turned out to be google having a bit of fun because the spooky explanations were just too darn spooky :)
1 Nilirai 2018-03-17
RemindMe! April 18 2018
1 Mancelut 2018-03-17
"/u/lmgbylmg joins this thread, saying he knows Ty and shares some of his conversations. Last one he posts (https://imgur.com/a/b8t6X) has Latin with an image of a priest (?) "exorcising" a "demon"
The Latin text reads:
Omnes mos mori
Which means "All will die"
Depellendam malum
which means "Dispel the bad"
UPDATE Quote Ty AKA https://twitter.com/strayedaway has deleted/changed the name/deactivated his Twitter account as of 17-Mar-18 @ GMT 1600. Guess the stress/messages got to him after all. /u/lmgbylmg knows him IRL, so do keep us up to date about him /u/lmgbylmg"
The latin is complete giberish, accross all forms of latin, someone just entered it into google translate and hoped for the best. If someone was wanting to get a message out without somone knowing, they wouldn't pull up google translate to facilitate.
Latin is generaly written in Subject-Object-Verb
Omnes is either in the Nominative/accusative/vocative plural of the word Omnis. Omnis is not a proper noun, it is an adjective and must be accompanied by a noun. Because it's next to Mos, it forces it to be in the nominative case. 0It's placement should be the nominative case as it is the subject. So "The All"
Mos is written in the singular of the nominative/vocative case, if you were pairing it with the subject, it should be in the plural as well due to the rules of apposition, but it isn't. If it is the object, then it should be written in the accusative case, which would Morem (singular) and Mores (plural). This way, the word mores would be the subject of the verb. Now, Mos is an interesting word, because it has many definitions and many neuances. Primarily: 1. manner, custom, way. You can see how mos has now become giberish in the sentence as it is not the correct word, and it is not the correct case. This is where google translate does its best. you don't typically see sentences starting with the accusative case in latin, but it can happen, but mos would still have to be in the accusative or at least the dative or ablative case to make any sense.
Mori is a verb, and does show up at the end of the scentence, so yay for that. However, it is in the present active infinitive form of morior. Morior means "I Die, I Decay, I wither." In the Present active infinitive, mori means "to die, to decay, to wither."
So to put omnes mos mori, either directly, which can happen, but that's in poetry, and this isnt prose and very rare. It's called transliteration and you can't do that with Latin. Very rarely at least, and you have to be very skilled. so the transliteration is "All manner/way to die."
Depellendam is the feminine accusative of Depellendus, which is a particple verb of Depello. So it should come after malum, not before. In the participle form, it means means "Which is to be expelled, repelled." Feminine is the first declention, masculine is the second and neutral gender is the third. This is important for malum.
malum is the second declention, and it is in the accusative, malum means "1. an evil, misfortune, calamity; 2. harm, injury." So that's a win for google translate. Unfortunatley, it makes Depellendam in the wrong gender. Since there is no context for the second line of text, we have no gender. That context comes from a verb, and there is no verb.
if we excuse the misgendering the words, it doesn't translate as "dispell the bad" is translates as "the expelled bad" or "the bad expelled" all will die, dispell the bad
Furthermore, none of these are substantive clauses, as they do contain nouns. In order to make this makes sense, here is a latin translation with what i have to work with Omne moriturus, malum depellite Omne moriturus, Malum depellite (present impreitive case, used for issueing commands)
all about to die/going to die, evil/misfortune/hurt/injury drive out, remove, expel
English Translation All [are] going to die, expel the evil.
1 ReedYyyy 2018-03-17
I've been snooping around heaps of posts on r/conspiracy and others like the 'solve 41818' page (sorry don't know the exact name). And I'm pretty fucking excited of all the shit people are finding, hoax or not it's cool to be apart of something like this.
1 Schamottriese 2018-03-17
Let's assume this is real.
Why would beings who can travel across sun systems or even galaxies send a TWEET or a voice mail? This whole "Alpha Bravo Charlie" nato alphabet thing also makes no sense. That would be overly complicated and clumsy, can't they form normal sentences? Then the numerical strings - they can be coordinates, phone numbers, astronomical coordinates whatever.
I think this is a really well played ARG. The riddles sound and look spooky and psydo difficult to solve but everyone with an IQ over 80 can actually still manage to figure them out. Whoever created this played right into what people love: Getting together and working on conspiracy theories using their fantasy and imagination while pushing each other further.
This could 1:1 be a Creepypasta and it'd be a nice read. Very entertaining stuff indeed but I am absolutely sure it's fake.
However, there IS something going on, we all know it. We feel it but we close our eyes like children afraid to look when they suspect a monster in the dark. We are afraid to see it for what it really is and they know it. We may find out sometime but maybe we won't. Some already know. Some have seen, heard, felt...or even more. There is absolutely no doubt that something or someone, some entity is here already and has been for a long time in one shape or form or the other. But this little prank is not it although we all like to dream about the "what if..." :-P
1 Arszilla 2018-03-17
No one ever said its 'aliens' sent it. Maybe a human sent it as a warning
If the VM and the twitter accounts are fake (some are fake, debunked. /r/Solving41818 )we found out about two youtube accounts; County Bluff and Stopswitch Proxy which have been sending encoded messages for well over a year now. So this is deeper than just the BS that came on last week.
1 thunderflame2 2018-03-17
https://twitter.com/d6a7c7617be97c1/status/975444853906690049?s=19
1 Arszilla 2018-03-17
Context?
1 thunderflame2 2018-03-17
Idk
1 thunderflame2 2018-03-17
17 17 9
3 2 7
23 22 1
2 11 2
3 1 2
2 1 1
7 7 5
4 6 1
2 17 6
3 1 1
2 1 10
3 1 5
7 23 2
2 1 10
18 18 3
2 22 7
1 Graphismo 2018-03-17
Very Nice Post
1 zedocax 2018-03-17
i feel like this is all a publicity stunt for a movie
1 Kingbeesh561 2018-03-17
Just a curious Question... Do any of you believe there's actually a non human entity or entities out there that we don't know about? Aside from aliens..
1 fykusfire 2018-03-17
I love these types of posts.
1 CodeSpent 2018-03-17
Does anyone find it odd that Fortnite has implemented some cryptic hints at this as well?
The theme of the season being space and astronauts, and over the last few days there has been strange controller vibrations which is morse translated to SOS D5 418. D5 being Tilted Towers and 418 being in reference to this theory..
Seems very strange.
https://www.reddit.com/r/FortNiteBR/comments/88i57r/controller_vibration_translated_to_morse_audio/
1 AutoModerator 2018-03-17
While not required, you are requested to use the NP (No Participation) domain of reddit when crossposting. This helps to protect both your account, and the accounts of other users, from administrative shadowbans. The NP domain can be accessed by replacing the "www" in your reddit link with "np".
I am a bot, and this action was performed automatically. Please contact the moderators of this subreddit if you have any questions or concerns.
1 Cva110601 2018-03-17
Guys just a information on the 18 april 2018 date 18 is one mysterious and important no in Hinduism's book the mahabarata war just google you will see a quara link you will be shocked to see how much importance gas the number 18 got.
1 Timoo_ 2018-03-17
Hey, this might be nothing and all but I was watching videos about this and suddenly i got a call from an unkown number. i was a bit freaked out so i did not pick up. i live in the eu and most people here use whatsapp so i tried adding the contact to my contacts so i could message them via whatsapp. the number did not show up in whatsapp so the number doesn't use it. i messaged the number a questionmark and i don't know if i should call it. it probably is nothing but still idk.
i was just freaked out by the timing and its very odd here to not use whatsapp, wtf.
1 lorney1 2018-03-17
just watch it be another one of JJ Abram's Cloverfield guerilla marketing....
1 Horror_Scary 2018-03-17
Whiskyechoalphatangohotelechoromeo is weather in military alphabet
1 ImJustVeryWeird 2018-03-17
When hijj37 posted whiskyechoalphatangohotelechoromeo@hotmail.com I was like “I WiLl EmAiL tHeM” but then I saw it was in dat military alphabet and it says “Weather” so my guess is on April 14th there is going to be some big weather related thing happenin
1 WeedGreed420 2018-03-17
have there been any updates to this story? been following through but havent seen anything new come up as we are approaching the end of days!!! ahahah
1 BAKRO2000 2018-03-17
Just a few pieces of additional information:
The title of the motorbike riders video translates from Indonesian into: Strange Beast in the Forest Caught Camera, info Aceh
And the video recording from Cicada370's page that was reversed by an unknown Redditor contain military code as well, when decoded gives this:
LUNAR IS HOM WITH SPACE TRIANGLES ARE BUILT WITH HASTE
1 123NINTENDO 2018-03-17
Oh no
1 mattzilla2000 2018-03-17
I kinda hope this is real cuz i could really go for some end of days type shit.
1 Hectag 2018-03-17
Tilted towers April 18th. You will be missed
1 CodeSpent 2018-03-17
Turns out my assumption of a connection with Fortnite has a lot more truth than everyone believed, which has me pretty excited.
1 cr4kc 2018-03-17
this just an extremely well done arg. i applaud the creators as its extremely interesting.
1 wholland06 2018-03-17
But why would they invade us? and more, why would they want to harm us? I'd like to think we could work together to make a better galaxy, and trade technology and things from our planets.
1 jagmantistribe 2018-03-17
It’s a fortnite publicity stunt. I’m calling it.
1 CodeSpent 2018-03-17
I posted here relating to connections to the cryptic Fortnite meteor and Morse code a little over a month ago. The few responses I got were people calling me out.
Well I'm back to say tomorrow we'll know. ;)
Considering there's now news of potentially merging Save The World and BR, it seems very likely this was a Fortnite ARG and "not human" relates to the husks.
The malysian flight seems a red herring or misinterpretation.
1 coolebalou 2018-03-17
what i suppose to do today 04/18/2018
1 pacificae 2018-03-17
I highly doubt this has anything to do with Cicada 3301. Too faulty, and no PGP.
1 Arszilla 2018-03-17
We stated no PGP since the start
1 pacificae 2018-03-17
Yes, exactly. I'm sorry, I was aware. I was just giving my two cents.
Anyway, it's April 18... I wonder if there's any progression to this
1 Arszilla 2018-03-17
Totally fine.
1 Nilirai 2018-03-17
So...... We dying today, or what?
1 Outhouse069 2018-03-17
Ok thanks lol I forgot about this comment XD
1 YoItsDash 2018-03-17
Well, we aren't all dead.
1 StefanNixdorf 2018-03-17
You can't imagine my relief man haha
1 Rosanbo 2018-03-17
So this turned out to be a nothing fest. Just some asshole putting puzzles online.
1 Arszilla 2018-03-17
PGP is a way of sending encrypted messages. Pretty Good Privacy is what PGP means/abbreviates to.
1 Mertespackers 2018-03-17
Well this was pure cancer
1 Arszilla 2018-03-17
So was writing on a 4 month old thread
1 Mertespackers 2018-03-17
So you just called your own thread cancer? Thankyou for agreeing with me 😄
0 Nascarfreak123 2018-03-17
So if this thing mentions Hawking’s death before he died. This has to be real than?
We’re fucked
1 Arszilla 2018-03-17
I couldn’t find the tweet regarding Hawking again and I tried checking my browser history on PC but I believe I noted it from my phone so take that part of the story with a grain of salt.
2 Nascarfreak123 2018-03-17
Than why did you include it being referenced before his death? Could that have been a troll most likely or did it come from the original source?
2 Arszilla 2018-03-17
I had the link saved/in an open tab but then I lost it. I’ll either dig it out or edit the post and remove it. But all these started before Hawking’s death (March 13th @ 9:57 AM) so yea.
EDIT
Since Ty deleted his account I don't believe I can't confirm this info again so I'll cross it out.
0 Nascarfreak123 2018-03-17
But it did exist that tweet than so we shouldn’tv take it with a grain of salt unless it was an ARg and including the Morse code and referencing him was planned. There just seems something fishy about this
1 Tinfoilxeno 2018-03-17
What date does it give for Hawkings death? He died on the 14th but it had been reported as the 13th in some countries because they were in a time zone where it was still the 13th when the news broke, if that makes sense?
That said, if the message really DID arrive prior to his passing, then the implications are terrifying!
0 LoveableCancer 2018-03-17
Can someone ELI5
3 Lions_for_life 2018-03-17
A twitter user received a voicemail with a prerecorded voice saying different letters of the NATO Phonetic Alphabet. When translated it read "S Danger SOS. It is dire for you to evacuate. Be cautious. They are not human. Danger SOS Danger." Since then he's received a ton of DMs on twitter with numbers, more codes, and messages in other languages from random accounts that seem to be throwaways. One message translated to "you need to delete the post about the recording." Others have referenced the date 4/18/18 and Malaysia Airlines flight 370. The original voicemail included a string of numbers that appear to be close to the coordinates of where 370 went down. Some of the accounts that messaged the OP have posted cryptic messages and videos that lead to various things seemingly related the flight 370. There could be some sort of truth to what's happening or it could just be a game or promotion for something.
0 k5blazer 2018-03-17
If the aliens kill us before I build my chopper im gonna bike disgruntled af
0 PID1_ 2018-03-17
Thats Morse code, not Braille!!!!
Ffs. The fact that no one has even called out a blatant error says the same thing about people here.
2 Arszilla 2018-03-17
Sorry for my mistake. It was a honest mistake. I mixed them up, my bad. Fixing.
0 PID1_ 2018-03-17
Okay. That's great you're correcting it but in all your searches to "translate" Morse to English, how did you miss that every translator out there calls it Morse and not Braille?
2 Arszilla 2018-03-17
I was out of my mind. Imagine this; you see one word and it gets stuck on your head, so it replaces another certain word you were gonna use. I fixed it now, apologies again.
1 PID1_ 2018-03-17
Alright. Good luck. Interesting post too.
0 tkowalski 2018-03-17
Marketing for the new Pacific Rim movie and good marketing at that. Coming out in a week. If I remember didn't they do something similar for the first movie?
4 Arszilla 2018-03-17
If you said Cloverfield like others that could have made sense but Pacific Rim? Nah.
1 tkowalski 2018-03-17
Why not tho? Movie is set in the Pacific where people are saying these coordinates point to, well more Indian ocean I guess, but still very close. It must be marketing or the "codes" wouldnt be so easy to break down.
Dont get me wrong, I would like it to be something real too just for the awesomeness of it and I will definitely be following until it is figured out.
3 KayleighEU 2018-03-17
There's no way in hell any marketers would use something potentially linked to a real life missing plane for their promotion. That's tasteless.
2 tkowalski 2018-03-17
I made have missed it, but where is the direct mention of flight 370 from the original account? I may have missed it but was under the impression that the connection was being inferred and not a direct mention.
0 Klawsterfobia 2018-03-17
Ok well I was just posting it cause someone asked and I never said it was for certain related I said could so that’s why I posted.
-1 SepticPotato619 2018-03-17
I'm sorry, I would like to consider myself a strong individual, but what I witnessed that day after hours and hours of digging on the del web is something that I would rather not relive. If you are morbidly curious enough to search for it, I must give you the disclaimer that I wish was given to me: If you decide to watch the Grifter, there is a possibility that what you see, might forever haunt you, stay with you, change you..
1 jennayyy_26 2018-03-17
Can you give a description of what it Is? And what does it have to do with this thread?
1 candyfaery 2018-03-17
I second this
1 jennayyy_26 2018-03-17
So I googled it, and I think it's just a creepypasta that originated on 4chan. I can't find a so-called video but only the same vague comments about "worst video, life changer" stuff.
-1 R_Kelly_Loves_Whites 2018-03-17
uhhhhhh what the fuck. Right after I viewed this thread, my girlfriend got a text from a spam number that said "ZQaBZf sidewalk. The long cons are much more elaborate"
-3 thepr0nqween 2018-03-17
I think this is fake. Every video I have seen has a red band on his voicemail running across the top, just like an app that accesses the phone mic etc. Link: https://discussions.apple.com/thread/7830243
5 Griiffiin 2018-03-17
When you screen record it does that lol...
1 thepr0nqween 2018-03-17
facepalm I haven't seen the original, so I wasn't sure if he was filming it from his phone and then others were posting screen records etc. but touche haha
-5 [deleted] 2018-03-17
[removed]
1 RecoveringGrace 2018-03-17
Rule 1
-6 187ninjuh 2018-03-17
Man... You guys need to get outside more often.
-18 [deleted] 2018-03-17
[removed]
7 neverwinterblight 2018-03-17
Why? Even if this is an elaborate hoax it's still entertaining.
-1 crabsneverdie 2018-03-17
It sure is
3 [deleted] 2018-03-17
[removed]
1 Balthanos 2018-03-17
Removed. Rule 10
1 aleister 2018-03-17
Removed. Rule 10.
0 Lions_for_life 2018-03-17
Huh. I wonder if he deleted it because he didn't want to deal anymore or maybe because someone made him do it.
2 lmgbylmg 2018-03-17
I just saw he deactivated. I’ll text him.
2 Arszilla 2018-03-17
Please do. At least let him know we need to screenshot the tweets so we can archive them, if he doesn’t mind. For the sake of progression and knowledge
Tell him to contact me via PM here so I can coordinate with him
7 Arszilla 2018-03-17
You aren’t alone. I personally hope this is real but not something that may end us.
1 Arszilla 2018-03-17
What is that?
1 Arszilla 2018-03-17
Oh. I didn't notice that. But I don't believe that website is related. Maybe a coincidence.
6 BigC23 2018-03-17
This comes after Valve announced they are shipping games again. For what its worth, Portal 2 was released April 19th of 2011. The more I see this the more it sounds like we have an ARG on our hands here for Portal.
April 18th is the day the Portal 2 ARG countdown finished. http://valvearg.com/wiki/Investigation_History#April_18
27 Arszilla 2018-03-17
lmao
priorities
1 Im_naK 2018-03-17
It could easily be an altered image of a plane taken from Google, right?
1 MaestroBelarious 2018-03-17
Does look similar. Thx
6 YouSaidWut 2018-03-17
I did 5 minutes of research so this could be nothing but:
http://1711141131131.xyz/
Seems to be related slightly
1 Waffle_Bat 2018-03-17
I haven't heard of this. Care to summarize for us?
1 klypspryngyr 2018-03-17
This userlink ain’t working? Everything you click on just gets more shady and frustrating Edit: nevermind , I got it
1 Arszilla 2018-03-17
Looks like he deleted the account. Will edit the post when I am on PC again5 chipple2 2018-03-17
Half life 3
2 Griiffiin 2018-03-17
Yeah and all the other weird accounts and videos
1 Arszilla 2018-03-17
Dont know but shit gets “fake” when they claim to be Cicada
3 DesignGhost 2018-03-17
And to cause huge public backlash by using a tragedy to advertise a game.
1 samjaam 2018-03-17
Wow wtf ... Link to this?
1 TomPimpachu 2018-03-17
According to some bs on YouTube, there's "evidence" that leads some to believe the rapture will occur on that day anyway, due to some Jubilee Year ending or something Jewish. Hugely paraphrased but that's the what I picked up on it based on the few videos I've watched.
1 lifeinthefastlane999 2018-03-17
Your story is more interesting than whatever is going on with the voicemails imho
1 -spartacus- 2018-03-17
That is actually accurate to say "time has no meaning where I am now". It is also interesting it took place in a dream where it is much easier to communicate because there is less barriers but also makes harder for the person with the dream to make sense of things because there's less perfect translation between sides of the veil.
1 samjaam 2018-03-17
"Non humans?"
1 DeerNoiseUpInHere 2018-03-17
Wait, the new one for the Switch is an entirely new game? I assumed it was the WiiU one rereleased...
1 trainstation98 2018-03-17
If this ends up being true I will eat my sock
1 ChinaXpat 2018-03-17
Just look at Nostradamus' predictions for 2018.
Sounds like Rick Stimson passed you a message from the other side, probably knowing you would post about it here.
1 SailorDak 2018-03-17
I honestly feel that that the plane and cicada are entirely unrelated. That is my intuition. On the other hand, something about that 4/18/18
1 Arszilla 2018-03-17
I will be sure to add this to the story. Quite interesting
1 Arszilla 2018-03-17
We believe that Hijj/Cicada was a troll. Real Cicada gives a PGP key before their shit starts. These people didn’t and even opened DMs.
This was provably a troll or something trying to slow the progress down
1 Arszilla 2018-03-17
Its Hex Code.
Translates to
The post will be updated in the upcoming hours. Woke up a bit ago, trying to handle the messages I got. Got over 300 over my sleep. I also got a cryptic message in my inbox.
1 degurecchan 2018-03-17
*before Darling in the FranXX ends
because I can't imagine not knowing what happens in the end of it
1 ZeerVreemd 2018-03-17
Should this matter? Pleas read my other comments.
1 notraven 2018-03-17
The original message seems real, digging around i found that a few unrelated other people had apparently received the same voiced message.
This twitter account stuff seems fake though. The messages have been getting less believable with each one, and looks like whoever was behind the twitter accounts seems to have run out of ideas, since we're now down to simple number -> letter conversions. Not to mention they opened up their DMs at one point to answer questions privately, that was a dead giveaway for me.
1 MesaBoogeyMan 2018-03-17
Or bad company 3
1 notraven 2018-03-17
Don't think so. The original message seems legit, seeing as other people received it too (AMBER seems to have been bugging out at the same time as well, so maybe something was up with comms at the time which caused the message to be sent to another device?).
I think we can agree that basically everything else around it is fake. The twitter accs dropped the ball with more and more contrived messages, threats and even opening DMs (an obvious red flag for me).
Then some accounts started posting the same kind of encrypted messages right here in this tread? Yeah, we're getting played.
1 Arszilla 2018-03-17
C3311 did not post a PGP. So not really.
1 ChinaXpat 2018-03-17
http://time.com/3990305/william-shakespeare-cannabis-marijuana-high/
1 lilybear032 2018-03-17
why do I have so much de ja vu reading this..?
1 pink_bowie 2018-03-17
idk if this is related or not, but: http://www.bbc.com/portuguese/internacional/2016/05/160506_san_andres_terremoto_if (sorry, PT-BR, but google translator can help)
1 Rokuro377 2018-03-17
Im gonna be pissed if the world ends and dark souls remaster doesn't come out
1 KayleighEU 2018-03-17
It'll feel better when I weed you out, precious.
1 delawareislife 2018-03-17
But if you dm me illl send my fb
1 Arszilla 2018-03-17
What do you mean it boots you? I don’t like using FB btw.
1 trenchywalker 2018-03-17
If this is an ARG for Portal 3 I'll fucking dance naked at work.
1 KayleighEU 2018-03-17
It's much more relaxed without you.
1 Arszilla 2018-03-17
No one ever said its 'aliens' sent it. Maybe a human sent it as a warning
If the VM and the twitter accounts are fake (some are fake, debunked. /r/Solving41818 )we found out about two youtube accounts; County Bluff and Stopswitch Proxy which have been sending encoded messages for well over a year now. So this is deeper than just the BS that came on last week.
1 Isharc 2018-03-17
Or, humanity will come into contact with an ET species.
Also, it could be an ARG.
1 Detectivish 2018-03-17
..but you're assuming that the alleged distress call was sent from a plane that was about to crash, when it's been heavily implied (imo) that, in fact, there was no crash & something altogether different happened to the flight.
1 Arszilla 2018-03-17
So was writing on a 4 month old thread