If the world ends before smash 5 comes out I’m gonna be pissed

man I’d be more pissed if the world ends just Days before Infinity War comes out

Half life 3

By that logic the world will never end

Guild this guy!

Here's the real conspiracy - "how valve used the promise of half life 3 to dominate computer game sales."

Wait, the new one for the Switch is an entirely new game? I assumed it was the WiiU one rereleased...

*before Darling in the FranXX ends

because I can't imagine not knowing what happens in the end of it

Ahh a fellow man of culture.

Or bad company 3

Im gonna be pissed if the world ends and dark souls remaster doesn't come out

Plot twist: this is viral marketing for blops 4

I highly doubt any company would use the disappearance of a real flight in their marketing. That screams poor taste towards the families of those missing.

For black ops 3 they pretended Singapore got nuked for viral marketing, so its not too far from reality

Remember, No Russian.

Dude I’d buy that game

Looking at the YouTube channel with “song for Jack” and the moon video, it becomes more obvious that’s an ARG of some sort. Could all be for a new Cloverfield film

The next film was has already been shot, not sure about plot and if it would potentially fit here though.

https://www.gamespot.com/articles/cloverfield-4-has-been-filmed-and-its-a-world-war-/1100-6456416/

Check my last post. I was curious to see if you've seen that yet? If it's a legit video, it'd be very hard to explain conventionally. And sorry if you mentioned it in your original post!

No, the video of something that runs out in front of the dirt bikes and then takes off. It's so strange, it actually outruns them for a bit. It supposedly happened near the crash site. I emphasize supposedly.

[removed]

He means that they filmed two movies to be released in 2018. The one that's on Netflix called "The Cloverfield Paradox" (also known as God Particle) and one that comes out in October that takes place in WW2. The one in October is being called "Overlord" for now but it may just be a placeholder name.

Clover field comes out April 20th. Could be that this aw a good part automated and the date was moved after the automation.

Actually it's ARG by Valve for Half-Life 3, being released 18.4.2018

This is what I'm also going with. Could be Portal 3 as well. I mean Aperture Science is mentioned in one of the images so it could be either.

Aparture Science is mentioned also in art of previously canceled Half-Life 2: Episode 3, where plot was about missing ship called Borealis which travels through multiple realities.

Yes could be Portal 3 as well. Portal 2 was released 14.8.2011 http://valvearg.com/wiki/Investigation_History#April_18

It better be tbh

Id be ok with this.

This is really fun and a fairly in-depth shot at some kind of ARG experience, but what about this feels like an authentic trail? Why would everyone be tweeting public messages in code if this is alluding to something so secret? Then, the "smoke weed" .onion site.. Come on. It's over. Trolled. It was a goof & a gaffe.

But don't get me wrong, keep posting links here. It's a great time. But so, so clearly orchestrated for entertainment.

What do you mean by legit and real?

If it is, it would probably be for zombies not campaign. I don't see then bringing in aliens to the campaign unless "they are not human" means robots.

They are us but not us that would to me tell me body host kind of like parasites that latch onto humans and become them so they are us but they're not us

Sounds like that Annihilation film that just came out! Only mentioning because I just saw it so it's fresh in my mind.

Waz the movie good? So many movies today are such trash.

Pretty much what came to my mind.

Definitely wouldn’t doubt it. Could be introducing robots/terminator esque things. That would tie in with the robot shit. Plus the numbers tying in with the first blops.

I believe this is marketing for Cloverfield.

Never piss off the internet. You will sell 20 copies.

Thank you for putting it into a cohesive timeline. I’m not gonna lie... this shit is beginning to scare me. I’m hoping with all of my being it’s just an ARG or something, but I don’t know... when I listened to the voicemail, I got chills. Legitimate chills.

Keep us updated, okay?

I mean, it should the voicemail was designed to be creepy. Its a LARP. A really fun LARP so i'm down to partake. the whole thing unfolds like something written by a sci-fi author. Encode all these messages in easily decipherable formats, but add some mystery and switch up the formats, brail, ascii, etc., rather than use one because reasons. Create the illusion that these messages are supposed to be covert. Vague allusions to monsters, aliens, as if out of a halloween thriller trailer. Oh, some solar flares from billions of miles away had the infinitesimal fortune of somehow hitting MH370, another thrilling mystery, to cause the blackbox to for whatever reason transmit its dire warning (oh and these solar flares were only magical to that plane and didn't cause any electronics elsewhere in the world to malfunction)

Props to whoever took the time to put this together for our enjoyment. Even though its fiction, I like it -- like a murder mystery dinner. (sorry for breaking the 4th wall for anyone else here to enjoy the larp, but I think the disclaimer is wise for newcomers)

"Reality" is a LARP...

mind blown.

Now who is creating it, what might be messing with it and why?

I doubt we’ll ever find out, perhaps we find out after we die? Ps plz don’t kill your self to find out

Don't need to, i already know WE are All creating this "reality" together. Everything is Energy, frequency and Vibration, everything is One.

Now could it be that some artificial evil is messing with Humanity so we accidently miss-use our Natural creative power and unwillingly create its desires?

Now could it be that someOne is in controll and will be shown to everybody soon becouse of a Natural and foretold event. And could it be that some are trying to discquise this Revelation as an false ET attack? Could it be some are trying to create chaose and fear while it is actually a beautifull event that could to the evolution of Humanity, but if we are not carefull to the devolution of Nature to artificial?

there is no ET attack. anyone who says there will be is either pushing a flase flag agenda or doesnt know shit.

The live action is pretty awesome!

I agree on that, Enjoy.

The cut-scenes suck ass tho

hits blunt?

Should this matter? Pleas read my other comments.

isnt that basically what Shakespeare said?

Yes, and some are convinced there is more knowledge in his work to be found if one can crack the code. There are also a few questions on wether he wrote everything himself or not, strange things are surrounding this fellow.

I know they found weed pipes under his house with traces of marijuana in them. He was ahead of his time.

Marijuana is found often in ancient sites all over the world. I love such small facts as Shakespeare possebly being a stoner ;)

http://time.com/3990305/william-shakespeare-cannabis-marijuana-high/

If it is a movie or game they have already won my fandom

You're one of them and we don't believe you.

Lol

It's like a completely new, and totally under-appreciative, form of literature. It's like ghost stories for a world that doesn't believe in ghosts anymore.

sound like an actual investigation mission in Secret world Legends.

if you like this sort of thing try it out, its free

Damn you, man! I was letting myself get excited about the whole thing and trying to ignore the likelihood of it being elaborate LARP. Thanks for the level headed synopsis.

I don’t think there’s been a piece of evidence to completely prove that yet, we don’t know if it’s a LARP or not, could be for sure, you have to have an open mind about the situation at hand, could be fake but it also could be real. Maybe a little bit of both? Guess we will find out April 18th

Is this actually just a LARP? I'm freaking out man

alternate reality game

What's an ARG? I'm out of the loop

This

What's an ARG? I'm out of the loop

This started out really creepy with the original tweet but now we're in MCU Movie "Alien rabbits live in pyramids on the moon and they're communicating" territory. lol.

I’m confused - isn’t the rabbit thing supposed to be some type of like metaphor, it never crossed my mind these were real rabbits lol

Yeah but I feel like the idea of little alien rabbits on the moon furiously posting tweets is better than whatever metaphor the people behind this are actually going for

I don't know about the US, but in my country when the kids ask what is the moon / why it is there, sometimes the parents answer that there is a Rabbit trapped in there, so those rabbits thing kinda make sense to me

That’s just Goku’s fault

Are you from Asia?

I posted a link to a video in my comment above about the Chang e-3 rover that China sent to the moon, and it discusses "moon rabbits" a few times early on.

Is there anything you can add anecdotally as far as your understanding of the mythology behind it?

Im from Paraguay South America and I confirm that

How would that answer even relate to the question?

I'm trying to give a reason to why are the rabbits are related to the moon

I’m saying if a kid asked why the moon was there, how would “there is a rabbit trapped on the moon” be an answer in any way? It just sounds like a non-sequitur

I thought they just saw a rabbit in the shape of the markings on the moon? Kinda like how we say the “man in the moon”? 🌝

There is also the Uncle Remus story about Brer Rabbit scratching the moon, which is to explain the moon’s markings. I think it’s in the “How the Animals Came to Earth” story. Just an American moon and rabbit story.

Lmao, to each their own. I find this pretty interesting - lots of seemingly unrelated things though. Not seeing the significance of a missing plane

Lmfao

Total coincidence, but I -no pun intended- went down a bit of a conspiracy rabbit hole and watched this video last night and again this morning.

What China Found on the Moon is the Most Astonishing Space Discovery Ever

Around six minutes into the video they start to talk about the "moon rabbits". I'd suggest watching the entire video, because it also touches on some other elements that were in the tweets/messages, such as pyramids (tetrahedrons actually) etc.

I didn't even see this thread until maybe an hour ago, so I didn't find the video based on searches or anything, and it's obviously unrelated to any of the above, but oddly seems somewhat related.

Very disappointed...I thought they were on to something bigger than what r/holofractal knows. Watched the whole video. Hard to follow the guy in the last 30 minutes...like i was listening to a well educated man talking about flat earth. I see the connection though, nice find!

This has to be my favorite reply ever

in reference to the "lunar rabbits" i'll point you to the old japanese story of kaguya-hime. She was compared to a rabbit, due to bamboo shoots she wore resembling ears and the rabbit is connected with the moon

I feel the same way. The original tweets got me real shook. Once we get to the rabbits, I’m convinced someone took over the posting and is now regurgitating nonsense. Well it was fun while it lasted.

Why do you think "someone took over"? The person who originally posted this shit is obviously not legit and was heading in this direction

I’m sorry, let me reword this. I believe the [original tweet and voicemail] are not related to the cicada puzzles. But rather the poster of the cicada content used the voicemail as a sort of launchpad to release the next Easter eggs. Either that, or we MISTAKENLY linked the cicada/hijj stuff to the voicemail. But that’s just my own opinions/beliefs.

https://www.reddit.com/user/skimmer47/comments/8523q4/you_need_to_act

This is sure interesting

Damn that's deleted!

Damn that's deleted!

Damn that's deleted!

I’m getting that vibe too

I mean, my theory regarding that (assuming all of this isn’t just an elaborate hoax) is that the original tweet is real and that some of the other nuttier stuff is posted by crazies. Of course that tweet is going to attract hoax responses.

Certainly fascinating.

Yeah the lunar rabbit thing made me laugh. Too bad because the original voicemail and mh370 connection was creepy. Less is more.

Donnie Darko

If this is advertising for a game it's pretty fucking dark and has gone a little too far with that dead body vid.

Trying to figure out the motive for using MH370 as the story base.

Maybe just elaborate ARG but what's with the April 18th date? Maybe unveiling of a different type of game or movie studio?

Interesting nonetheless.

MH370 is a HUGE conspiracy and biggest enough to draw interest from everyone

And to cause huge public backlash by using a tragedy to advertise a game.

Yeah, because of that I don't think it's a big game company creating it. I'm thinking more edgy and underground, someone having fun with it in a basement, which means it'll take a while to fully come out who is behind it.

The past cicada puzzles were all legit and post mortem analysis of them suggested high level code breakers. We are talking only a stage agency could pull these off. In the past as people reached the end of solving it, they suddenly go silent, suggesting they followed through with being recruited.

have any links to some of the people who were close to solving it that went silent?

I don't know about going silent, but this is the story on the guy who cracked it.

https://www.fastcompany.com/3025785/meet-the-man-who-solved-the-mysterious-cicada-3301-puzzle

Came scrolling just to find this ! I knew I’d seen the name before, Didn’t people suspect the government seeking advanced level code breakers by placing these all over the clear & deep web?

No man's sky did a massive viral marketing arg for their last patch. They are currently working on another patch

I was typing in April 18 on Google and one suggestion was "April 18 rapture". Some people online say the rapture is going to start on that day.

According to some bs on YouTube, there's "evidence" that leads some to believe the rapture will occur on that day anyway, due to some Jubilee Year ending or something Jewish. Hugely paraphrased but that's the what I picked up on it based on the few videos I've watched.

Yeah, and one guy's article I read who said it's false and won't happen brought up a biblical generations and the people who saw the formation of the state of Israel. Christ taught that the generation who saw the creation of the state of Israel would see him come back. However, the length of a biblical generation isn't really stated at all in the bible so people assume the length of one.

People can say all they want but only God himself knows when everything takes place, not even his son. People can use all the details in the bible to estimate when it's exactly going to happen but they'll be wrong. There's signs of the end times out there all over the place however though.

Here's the article if you even want to read it: https://www.prophecyproof.org/2018-rapture-parable-fig-tree/

Imagine being god and the disappointment when coming back to earth for your "chosen people".

Dead body vid?!

This is the first I’ve heard of that too. Wtf?

What’s the dead body video??

Yeah I think this is a hoax, possibly a prank but that's really dark to tie to any game, album or commercial venture. Pretty odd though and some pretty big leaps to connect the dots but we will know in a month if the alien overlords have finally figured we are about to destroy the earth and are stepping in.

Anyone maybe think the missing flight is part of it too

im having crazy deja vu right now for some reason

Awesome job on the post. This could easily be someone playing a prank right.

If someone has orchestrated this then hats off to them aha.

I’m on about the post and this whole voicemail thing too haha

Kinda hoping we’re all being played like a damn fiddle, don’t wanna die yet

It’d be a great way to go out though!

dont worry. reincarnation dude.

do u stress when your character in GTA dies? I mean sure, a little bit if you was drivin a sweet whip with lots of guns n ammo, but thats it.

Hello sir Arszilla from Valve. Your ARG marketing is cool, but when you mix irl lost plane full of people in it, well, if I would've had people I know missing in that accident, I would be superpissed for you taking advantage of it in your gaming marketing.

I don't believe you. You are part of it. It is well done you should sell it as a st book.

The past cicada puzzles were all legit and lost mortem analysis of them suggested high level code breakers. We are talking only a stage agency could pull these off. In the past as people reached the end of solving it, they suddenly go silent, suggesting they followed through with being recruited.

recruited?

Yes.

recruited for what?

CIA
https://en.wikipedia.org/wiki/Kryptos

The date 18/03/18 is certainly super self-referential.

I saw something about tomorrow's date in relation to space weather and found this.

Whether we're aware of it or not, something is going to go down.

No it isn't. I won't bother arguing now, I'll simply check back tomorrow, when nothing has indeed, gone down.

Well aren't you a charmer.

Has anything happened yet?

Well there was the rigged Russian election, but nothing really happens down under, does it?

Nah Australia has ad many LARPS as any country. It just depends on how many people are interested in playing.

Hey, no hard feelings, fella. Here's Paul Hogan on Australia.

Where did todays date come from? I was trying to find why today was being referenced but generally couldnt find anything about it

What I mean by self-referential is, you can get those numbers in any number of similar ways with 3's and 6's leading to 18.

I half want t believe it is but it is so intricate that it makes me wonder, and also as someone who spends time around what most people call 'hippies' there has been a lot of talk of channelling a cosmic shift in 2018 and many of the ones I thought were kinda loopy have been saying things very similar to the latter of the decoded messages, tarting the past few years. Weird.

This is the sort of shit I like seeing on this subreddit, not a bunch of HILLARY CLINTON'S E-MAILED GEORGE SOROS bullshit.

One account said it would be the last time that it would dissolve. Anything after that is not the originator — just as those who messaged Ty in google translated Indonesian after the Malaysian connection was made were just tag alongs and mockingbirds.

You need to dig deeper into the claims surrounding April 18th and the documents I have provided from the CIAs reading room barely scratch the surface of what is available to you through the same.

Any good reading besides the 2 you linked in the thread?

https://www.cia.gov/library/readingroom/search/site/Project%20stargate

Shouldn't these be Classified ?

Declassified last year

Ohh, can you point out where it says Rabbit anf stuff ? Whoopping 29 pages lol

https://www.cia.gov/library/readingroom/docs/CIA-RDP96-00788R001900760001-9.pdf

Page No. ?

Read it in its entirety. None of it is unimportant.

I read it. Amazing, whateverthefuck it was. There’s more stuff like this on cia site?

much more

The hell is that??

Do you have direct links to other astral projection tests? I dug around for a but but they’re hard to find.

https://www.cia.gov/library/readingroom/search/site/Gateway%20program

REEEEEEE

Meh, shit like this makes real conspiracies look like a joke. The first message was good and reeling but once everyone piles on with bullshit it ruins everything. It doesnt take long before you can tell its bullshit.

Yeah, aliens would probably have used Snapchat instead of Twitter

They probably tried to use Snapchat but couldn’t figure out the new UI.

Ahh I saw this joke on Twitter past night mentioning Facebook live instead. You're right tho, they'd use snapchat

If they used snap chat half their followers wouldn’t see it since Snapchat is being boycotted right now

Probably tried to use Snapchat but they got word of Rihanna's call to boycott the app and followed her wishes.

Go to my user history and read my recent (long) post. I discuss the possibilities of it being an art project or similar.

The dead giveaway is "codes" that aren't real encryption. If you want to send public secret messages nowadays you 100% can, and it doesn't involve using pop culture historical "codes" like morse, enigma, etc.

Also the message says SOS and then says to evacuate. Why would you send a distress signal to someone and then tell them to evacuate.

Isnt it a sort of rule of thumb in writing believable fiction to start the story as realistic as possible and add unrealistic material slowly enough that people dont realize its all made up? I think I remember my middle school writing teacher telling us something like that

I just wanted to share that several months ago (at least 4 or 5 months ago) I received a phone call with an automated voice speaking a code in phonetic alphabet. It went on for less than a minute before the call just ended. I tried getting to my computer to look up what was said but I was so stunned by the eerie voice I couldn't even remember what was said.

I wrote it off as nothing and hadn't thought of it much until I heard the recording today of the twitter voicemail message and it was the same type of pre-recorded voice speaking. It freaked me out pretty bad as to how similar it was. Same voice. Very creepy. I remember when it happened I wished I was able to record it so my roommates could hear it... now I REALLY wish I had it recorded.

I use Verizon. I don't know if that helps but that is all the info I have to add. I want to say it happened around September or October 2017.

*edited for clarity

Try logging into your my Verizon and check to see if your voicemail is there? Pretty sure you can can read texts and listen to calls through Verizon I could be wrong though, worth a shot?

Thanks for your idea. However, it was not a voicemail. I answered the call and heard the recording.

If Verizon does have recordings of phone calls then maybe I can find it but I will have to wait until later in the week before I start combing through a couple months worth of calls seeing as I don't remember the exact timeframe in which it happened.

u from mkultra? they are trying to activate you

I had something similar happen to me and that's why this shit has me so spooked lmao. A while back I got a voicemail in this whole coded language thing and I just thought it was some spam shit so I deleted it. I use sprint. Anyone know if they hold onto deleted voicemails somewhere?

How long ago did you get the voicemail?

I'm not sure but I'd estimate around 5 to 7 months ago

Probably closer to 7 months. It was when I had my old phone. Now that I think of it... it was an iPhone that I got it on, like the other people that got it. I have a Note 8 now.

My only thing is if this was real why have codes that are easy to crack? If this was indeed aliens or government conspiracy, wouldn’t they have there own language AND not put it on one of the biggest social media outlets?

This is why I think it is a really well done ARG. Its is just hard enough to warrant mystery and reaction but not hard enough that if real government people wanted to get a message out, they could without it being cracked. Best guess is this is a movie, video game or cicada test.

But why would the government want to get the message out? Even if they did don’t you think maybe they would just say plain and simple if danger was involved or is this another Cicidia puzzle? Seems too faulty to be real

I think its a great ARG. Has me interested in more

Makes me think of a modern take on the War of the Worlds radio panic story.

why would the government want to get the message out

Because it's not real... it's another Q tier LARP. Some backwards text, cryptic words, weird fonts, braille, sprinkle of QR codes...

the backwards text and rune fonts being so low effort is what's making me think this is a sham

Likewise for Cicada.

I don't know what arg is, and at this point I'm afraid to ask

Alternate reality game.

Augmented reality game.

Augmented reality game

Alternate

Thanks man

If you're into movies, look up what they've done with the Cloverfield films. Fantastic ARGs, besides The Cloverfield Paradox

Not super into movies thanks for the recommendation though.

Like no movies at all?

4chan had the best ARG ever some years back. People coordinating on multiple continents. Some type of talking zombie container being transported. Really well done.

exactly, that's also what I'm trying to say...

rabbits podcast?

I was wondering this the whole time, what is a cicada test?

So yeah, I'm a little late on this one, but I didn't see a reply so here goes... It's what they call whoever has anonymously posted several puzzles & arg's for people to crack the codes, allegedly with the agenda of recruiting the best minds available for such groups as; CIA, M16, NSA etc... You should maybe Google it (if you haven't already lol) to get a better idea, but that's pretty much the gist, give it take a few details.

It's either an ARG, as you said, or Cicada 3301. Either way I find this cool.

Liber Primus to date is only partially translated, so it is not cicada3301.

If cicada make another communication it will happen with a PGP key and I would imagine it would be a clue to solving the Liber Primus, but even this is unlikely as they don't give clues as to how to solve the puzzles.

What is cicada3301

Super advanced and complex puzzles. You can read some Wikipedia article on it, and some walk-through of previous ones.

It's legitimately complex, so it's perfectly fine if even after reading it doesn't make much sense.

I did some reading, and oh my god. Holy hell.

This is stupid. Children scaring children with ghost stories.

Get back to Netflix then.

DON'T TRUST ASHTAR SHERAN

https://docs.google.com/document/d/1-Yg2vehTH-9apwgBg13uVTOcmUTcKB4RPOSSnju9P14/mobilebasic

Look to the Georgia Guide Stones. You time travel every time you look at the night sky, look back to Francis Bacon’s works and those of Albert Pike.

Time is a linear human construct, but we find that the Universe is fond of curvatures - look to our Martian past and our Venusian future.

Anti matter and matter are two sides of the same coin — the coin being AI. A long dead civilization some billions of years ago found that organic existence is unsustainable. In order to survive a supernova, or a galactic merger, they found that they must upload themselves into the fabric of reality. They have created subatomic machines which carry and are directed by the collective consciousness of the entire species. These particular machines which can take the form of subatomic particles, atoms, and molecules are capable of self replication at an exponential rate. Eventually, these machines encompass all that is and the species has effectively uploaded themselves into the entire universe.

Mesozoic Era Earth: Life has has had 186 million years to build upon previous iterations before the Mesozoic Era, intelligent life exists. They are aware of the impending calamity which is about to strike the Earth. Thankfully, their technology has allowed them to escape. They are those depicted in atlantean tales and Sumerian cuneiform. They are as native to the planet as the displaced indigenous peoples of the Americas, Africa, and Australia.

I am standing inside of our Martian past. There are waterfalls at this time on Mars and life is plentiful. Humans have lived here for some time with the awareness of a nearby habitable but inhospitable planet. Colonization efforts of Earth were called off on environmental and ethical concerns — and more notably: the ethics of colonizing an already inhabited world, effectively setting a galactic precedent for invasion against planetary life we deem lower on the evolutionary order than ourselves.

Then a calamity struck the solar system. It stripped mars of its atmosphere and wiped life from Earth. Mars had become both inhospitable and uninhabitable, and their only choice was to migrate to Earth. I dream of invasive plants, the dandelion native to Greece which chokes the National wildlife reserves of Alaska. They thrive because they are not from here, there is nothing to keep them in balance. Humans behave the same.

How similar the animal cell is to the earth in its shape and function. How similar the solar system nuclei with its heliospheric membranes? How like them are these galaxies revolving around a focal point — the nucleus which carries the instruction for the rest. How strung across the cosmos are these galactic cells in their formation of synaptic webs. Does a thought require subtraction or division? Would a thought subtract from infinity? Perhaps the universe is multicellular or perhaps it is particular.

are you okay

Death Stranding: A Hideo Kojima Game

This is now my fav comment on this whole thread

You win.

Can I get an elaboration on Francis?

New Atlantis

Very interesting. Can you recommend some reading material, please? Thanks!

So, when the voicemail came out, there were a lot of leads, in particular a strange one that came from this Twitter account:

https://twitter.com/d6a7c7617be97c1/ He responded to the account which posted the voicemail with a string of characters, which we will get back to in a second. However, when I saw his profile, I immediately noticed the video and the Tweet, which appeared to be a set of HEX characters. Translating them gave me "Scottie 1", which confirmed my suspicions that I should SSTV the video to get something.

So I did that using Scottie 1 as my RX mode, and the image produced is in the following link:

https://cdn.discordapp.com/attachments/424691289787858965/424753628893544448/unknown.png along with what we believe are the actual coordinates of the island, 16.837439, 112.335583.

All we know about the island is that it was likely created by China in the South China sea to extend their military operations, possibly as a fueling station. This island in itself isn't unique, and it's one of many.

I was working with u/eiggaMAD, which noticed that if you took out the letters in the username (not the Twitter handle), you get what could possibly be coordinates (6.77617977, 97.43046368). This is interesting because they are located around Indonesia, close to the coordinates mentioned in the voicemail.

He also noticed that the bio itself held the settings for an Enigma cipher, and using https://cryptii.com/enigma-machine, he decoded the characters found in response to the voicemail link. His screenshot is here:

https://cdn.discordapp.com/attachments/424691289787858965/424749993312780289/unknown.png The letters that spit out gives us the following line from H.G. Well's book, "The Time Machine":

great shapes like big machines rose out of the dimness and cast grotesque black shadows in which dim spectral morlocks sheltered from the glare

So that is where we are at so far with the Tweet and the voicemail! It is worth mentioning that we don't know what to do with these new lines of text, or if there is anything in the username or Twitter handle that needs to be decoded.

We also don't know exactly what to do with the picture, or with the characters on it.

u/Arszilla, please add to megathread. Thanks!

Check this out. I started with your original thread first without seeing any of the rest of this info from the megathread (I tend to ignore megathreads). Keep my ignorance in mind. I tried to retrace your steps, decoding the SSTV transmission just fine, then got to the part about the enigma machine, figure how you arrive at the rotor and plugboard settings, but for the life of me couldn't figure out how you arrived at the 4-18-18. Seemed like a lucky guess. (Or maybe you or your partner in crime eiggaMAD are responsible for d6a7....?). Anyway, not knowing the significance of 4-18-18 I decided to do a simple google search for the number in the twitter user's name.

Here's where it gets strange. There are a few exact hits, one of them is this link:

http://www.fns24.com/details.php?nssl=d6a7c7617be97c79d7d430463fa6af8f&nttl=0609201541818

It will bring you to a news article from 2015 that seems to contain a funeral notice for a Bangladeshi government official. Here's the odd thing. That long hex code seems to be very unique for every story on the site. So, I guess the twitter user must care about this story in particular, very much. In addition check the timestamp on the article: September 6, 2015. This matches the 06092015 from the URL (you can confirm this by looking at the URL format for other articles on the site). So, for the rest of the URL, that leaves... 41818 4-18-18. How strange is that?

Anybody know anything interesting happening on Sept. 6 2015? Unfortunately google news no longer allows you to search for a specific date. Only gives you headlines from today. Can't believe they screwed that up. Well, I guess I can... memory hole and all.

Anyway, just thought it was odd, but might provide some insight to you and eiggaMAD

Shit the link is down! This is creepy it was working for you right?

It's working for me now.

https://en.m.wikipedia.org/wiki/Portal:Current_events/2015_September_6

Non-Mobile link: https://en.wikipedia.org/wiki/Portal:Current_events/2015_September_6

^{HelperBot v1.1 /r/HelperBot_ I am a bot. Please message /u/swim1929 with any feedback and/or hate. Counter: 161043}

The island that you found is a place called Woody Island in the Hainan province, which is controlled by the Chinese(with claims of control by Vietnam and the Philippines among others). It's part of the Paracel Islands, and as of 2016 has surface to air missile sites installed on it.

https://en.wikipedia.org/wiki/Sansha

I've also thrown together an imgur album of some weird things I found on google images while looking at the island itself. There's a lot there, so I recommend going to it and looking around.

I've been checking out the youtube videos from County bluff There's the video 4/18/18 showing the moon, a rabbit in a chair, and the words THINK HOME. Then checking the Song for jack video in the description in NATO it says SOS APRIL VIEW THE MOON. If anything is set to happen with all this we'll have to wait till that night and see. I'll definitely be spending all night outside staring in the sky. If anyone has a good telescope set it up to the moon and maybe set up a live stream for people to see. I really hope this isn't an ARG or something a long those lines.

It’s gone.

Just saw it. At the 49 second mark in Song for Jack there is a particular focus on a set of dials with hour and minute. Also that video was posted over a year ago. It has to be Cicada with this level of planning.

I have a high powered telescope and will be using it to gather info

Y'all are all hoping it ISN'T an ARG but I'm just a small town motherfucker and I wanna get back to my farming and not deal with aliens or an apocalypse lmao

But I am interested to see what happens - I think it's an elaborate hoax. It's just been too easy to decode.

im positive this is all fake. also all of the accounts that messaged him were created right after he made that post (they're fake) and he deactivated his own account so im betting he'll just log back in one of these days and be like hey guys im okay or some shit. ANYWAYS i found his insta and ive been monitoring it to see if anything happens. Personally i think its all just a well thought out plan

Now this is the batshit crazy conspiracy stuff of old that I miss from you. I'm glad you're back.

I just meant in general about the content, welcome BTW.

Cute

There’s a lot of inconsistencies with this Twitter Voicemail stuff and I believe it’s an elaborate hoax.

1. Black boxes ping once a second for 30 days and then they run out of juice. It’s been 4 years.
2. Black boxes don’t use NATO phonetics.
3. A solar flare disrupts electronics, not amplify radio waves.
4. It is SUPER easy to fake a voicemail from an unknown number and then screen record it. All you have to do is set up an audio loop, get a friends phone, *67 and call your phone, leave a voicemail while playing that audio loop, hang up the phone. The voicemail will read “Unknown Unknown” and you can play the voicemail. Also, someone did mention in the Twitter thread that the voicemail was an audio loop.

I think he deactivated his Twitter account because he didn’t think it would explode like this, go viral, and have a bunch of people pouring in other information to add in on it. That’s just my 2 cents though.

something is happening

so far the only other source is a false cicada account unless I'm missing something? So how do we know anything is actually "happening"? I'm skeptical about anyone saying they received a call like this. Trolls are abundant when things like this come up.

Can somebody tell me what cicada is?

Hey so I was playing around with speech selection on my iPhone and I changed the voice to “Samantha(Enhanced)” and slowed the speech down a little. Went to notes and typed out the phonetics and it sounds EXACTLY like the OG voicemail.

Proof

I had to include the text of the message in there because it kept using a foreign accent when I tried doing speak selection and wouldn’t use Samantha(Enhanced)

I just compared them side by side. The original is a little bit faster and they say Foxtrot and all the numbers the EXACT same way. Compare them.

Here is the link to the tweet about Stephen Hawking.

but the date this was posted was 2 days after his death. So far I have not seen any evidence that this claim was made before his death. Unless the morse code message they received this from was included in the VM and I missed it.

“But still, something is happening.”

Wow you really want this

Hi sorry, I'm way late to your party & as we both know, today is indeed 4/18/18 lol. I just wanted to ask you one thing about your above comment. You stated, "So the voicemail is legit." I just wanted to ask you if you could expand on what exactly "legit" means to you? Do you mean that it's legitimately a voicemail from the bb recorder?

I still think it’s a hoax but it’s fun to watch nonetheless lol If I wanted people to believe this, I would *67 random numbers and leave that voicemail, just because.

I've been lurking in this thread for ages and the thing that makes the most sense to me is that the voicemail is actually a message from the ship that is supposedly searching for the plane that went missing for three days recently. Apparently the last day of the search time is April 17th and with the date in the codes being april 18th just seems way too coincidental to not have anything to do with the search.

They turned off their tracking system to revisit two points of interest and didn’t want to give false hope to family members that were keeping track of them. But that was in the beginning of February. They still haven’t found anything.

EDIT: Link to article

I had a dream awhile ago, like I think 2004, where I was told by a ghost that San Francisco would be destroyed in 2018. The particular date given to me, I think, was 4-18-2018. But don’t hold me to that it was like 12 years ago. But that’s the reason I’m even posting this, because if something is going to go down on 4-18-2018 and it involves the destruction of San Francisco, I would feel really weird about it.

In the dream, I was in an old house that used to belong to my grandmother. The house was from the 1800’s and as a kid I was sure it was haunted, but that is just my impression as a kid. As an adult I know it’s just a rambling old house. I still dream about it frequently as a haunted place though...especially when under stress.

Anyway, so I’m in this house and I was completely terrified. But I actually used to have a lot of night terrors, and after awhile of having my sleep messed up every night, I got kind of pissed off so when it did happen, I used to try to “confront” whatever was causing the terror in my dream. This was hilarious for my girlfriend because it often involved me getting up and flicking the lights on looking for something, then waking up and not remembering wtf I was doing. One time I had actually woke up to find I had pulled the twin mattress I was sleeping on up and barricaded it against the window. Fun times.

So in this particular dream, it started out as just a haunted house kind of dream, the kind where I couldn’t see the entity, but knew it was there, and so I confronted the entity in my dream. I started to ask it who it was, to show itself, and why it was there, etc.

The reason why I remember this, 12 years later, is because of the details. In the dream, the entity told me that he was a guy named Rick Stimson, who just died recently, and found out somehow that there was going to be something terrible that will happen and San Francisco was going to be destroyed, maybe by a meteor. He said that in life he worked as an emergency responder and saw horrible things in war, and was upset by this impending catastrophe and so was kind of breaking the rules to tell someone.

I pressed him on when exactly it was going to happen, because he seemed a little vague on that point, and I think I even called him out on the vagueness, so he replied something like “time doesn’t have any meaning where I am now, it’s hard to give you a date that would make sense”. I pressed further and he gave me April 18th, 2018.

So the next day when I woke up I remembered most of the details of the dream and decided to look up the details on the Internet. I thought it was kind of funny that his name was so specific. I don’t know anyone named Rick Stimson. I thought it hilarious that that’s the name my mind came up with for a ghost.

Weirdly though, In the first few search results an obit came up for a Richard “Rick” Stimson in West Chester New York, Vietnam Vet and Former Fire Fighter or something. You can still see that obit today if you look.

Anyway, just thought it was relevant. Probably nothing, and sorry for the length.

Your story is more interesting than whatever is going on with the voicemails imho

Agreed!

That is actually accurate to say "time has no meaning where I am now". It is also interesting it took place in a dream where it is much easier to communicate because there is less barriers but also makes harder for the person with the dream to make sense of things because there's less perfect translation between sides of the veil.

If this ends up being true I will eat my sock

Just look at Nostradamus' predictions for 2018.

Sounds like Rick Stimson passed you a message from the other side, probably knowing you would post about it here.

why do I have so much de ja vu reading this..?

I don't know, did I mention it in another comment somewhere? I don't think I have mentioned this specific dream, but I have talked about some of the night terrors in other comments. Maybe you saw one of those?

Or maybe you had a similar dream. Just from talking to people on here and elsewhere, it seems to me that night terrors seem to conform to a kind of formula like this. You are in a kind of semi-lucid state and see things and you have just enough motivation to get up and move the covers around or flick on the light. Then since you had that movement and often wake up not in bed, you retain some fragmented memories of the event. Then your brain tries to find meaning in the fragments.

I came across a post one day where someone was talking about her night terrors involving a floating old woman and also one involving something cartoony and non-sensical. I don't remember the details of her post now but some of the details were identical to a couple night terrors I remember having.

That is not to say I put much stock in night terrors as anything more than a waking dream. It could be something more, but if it is, it's kind of a lousy vehicle for prediction in my opinion.

idk if this is related or not, but: http://www.bbc.com/portuguese/internacional/2016/05/160506_san_andres_terremoto_if (sorry, PT-BR, but google translator can help)

Hey so I don't know if everyone has moved passed the rabbit part, but I just wanted to mention that with the talk of the lunar rabbits and one of the youtube videos depicting the moon and a rabbit from the children's book "Goodnight Moon" that East Asian cultures, specifically Chinese and Japanese have folklore about the shape of a Rabbit on the moon. There are two versions of the Chinese folklore, one being that the rabbit is the companion to a goddess and is pounding the elixir of life for her and the other is that the rabbit is pounding medicine for mortals. I don't know if this important, but it may be something.

There was a QR code that led to a website of last words from pilots of a plane crash. The last words from MH370's pilot was "Good Night."

I remember this!

yes, thank you! You are the only other person I've seen make this connection! Kaguya-hime, a princess from the moon, was often mistaken for a lunar rabbit due to the bamboo shoots she wore appearing like rabbit ears

https://en.wikipedia.org/wiki/Cicada_3301

I did 5 minutes of research so this could be nothing but:

http://1711141131131.xyz/

Seems to be related slightly

It could easily be an altered image of a plane taken from Google, right?

Guys it’s worthy to point out that the dead body in the Water Heater video is the mummified body of John Torrington, a member of the doomed Franklin Expedition to cross the Northwest Passage. He died fairly early in the voyage, on January 1st, 1846 when he was 20. I don’t know what connection this has to the rest of the story, but if I had to take some sort of guess it would be that both this expedition and the Malaysian Airlines flight were both lost.

Doesn’t the HL universe involve a ship getting teleported? I think it’s the ARG for Portal.

That’s possible, it was one of the theories I had for a bit.

or half life 3, sionce valve said recently that they are going to make games again.

come now, we're discussing actual possibilities, like aliens or lizard people.

There's a really obscure book talking about these giant humanoids in the arctic that killed the crew of the Franklin Expedition. Don't know if it's relevant though

Do you mean Frozen in Time?

Also the background music is from that story where a guy accidently heard a weird transmission.

I'm going to throw out a theory, and I really hope to be able to come back and elaborate on this.

What if this is some escaped, or even "naturally" occurring intelligence that is just trying to find a way to communicate to us through these digital mediums?

Because this is weird as shit, and it seems really elaborate for a LARP.

I like where you're going with this, I actually had a similar thought.

I am of the mindset that a lot of "extraterrestrial" life is FAR more complicated than we can even begin to comprehend. Everybody can visualize the classic "greys", and the more modern idea of reptilians, but I think that life exists on a level that we cannot physically see--not completely, anyways.

I believe that a number of UFO sightings are, indeed, spacecraft--but I also believe that a number of them are literal living things. I've actually had a personal experience like this, where I saw a light in a tree that seemed to know it was being watched, and it moved back and forth behind the leaves as I turned my head to watch it more.

Where these so-called "intelligences" originate from doesn't even totally matter to me; they could be from the moon, or from a dimension on our own Earth that we cannot normally see. They could always be existing right beside us, just like the flora and fauna we CAN see.

Where I'm going with all of this is, just like you said: They could be intelligent and capable of communication on a human level, but it could be extremely complicated for them to do so by conventional means--or even well-known esoteric means! I've heard many tales of other lifeforms communicating with humans via ESP or dreams, and I believe those stories.

And so, going off of your idea a bit here, I could absolutely see some kind of life form existing that cannot speak, not vocally or even with ESP necessarily, but a life form that IS capable of higher thinking, and IS capable of communication on a human level, and therefore has to do it in really weird complicated ways that barely make sense to us.

It could be that there IS life on the moon, and it IS among us here on Earth. And maybe it can only communicate digitally, through radio waves or even through LIGHT. After all, us humans have discovered some pretty bizarre ways of communication outside of speaking and writing. I'm currently conveying my ideas to you via digital input on a computer, and my words are being illuminated to you on bright lights.

I could go on--just saying, I totally hear ya :)

ET could literally be anything... hell there's a chance that it's invisible, why not?

That would explain the bizarre array of different codes and languages. It’s easy to just assume it’s some larper trying to make everything look edgy and mysterious but through your theory it would be an intelligence familiar with all our different methods of communication trying them all out to see what sticks.

You've elaborated for me, lol.

To expand, it could also be an AI or even a naturally developing AI.

Those glowing light type UFOs supposedly have some sort of weird connection to consciousness, if that makes any sense. The CIA is very interesting in consciousness... I think dreaming has some great significance we are not really aware of, it's not the random neurons firing like we think.

Look into Kozyrev Mirrors.

or maybe aliens are underwater and can't breathe air and are limited in what they can do and that was them trying to communicate with us

atlantis

Oh man, that's it, I'm convinced, Steven Hawking has uploaded his consciousness to the internet.

I mean, sure, but not so much.

Hawking was a black hat

Ou i like your theory , even if larp or arg I'm hooked lol

It's Tyler.

(just kidding I think it's a goof; also I think it is a Really Great Goof.)

I forget where, but I read something pertaining to “pour liquid nitrogen on them” or “rub them with liquid nitrogen”

It may not be related to this, but maybe that could be our weapon against them? If Nasa is demanding an April 16th deadline for the launch, then we might be informed or warned on the 17th. Are there any events or speakings around the world planned on that day?

Edit: Also another theory. Remember the rabbids game on Wii, where you destroy rabbits that come to earth or something? What if this game is related to this mystery, in terms of them preparing us for whats to come?

Someone in one of the threads tracked it somehow to some random pc game of some sort, anybody know more about that?

I saw a video of the pc game. It was very weird and 8-bit I think. At about 30 seconds into the video the audio is just the sounds of planes crashing.

Yeah it looked like some shitty NES emulator 90s kinda left right up down with a ball jumping with some red kinda futuristic background and thats it

Edit: name of the game was ".clos" or something like that. Whoever can find it maybe OP can include it

I feel that I've missed something--apologies if this has already been explained in the main post.

I do understand how everyone is viewing the Twitter as an ARG now. That makes sense to me because of the Cicada stuff. But what about the original voicemail and the connection to the flight? Did anybody ever make a 100% confirmed connection between the weird twitter account and that guy's experience? Did we ever figure out who he is, or what happened with him, or if he has something to do with the ARG?

Again, sorry--I feel like this has been mentioned. I just think I missed it because I don't totally understand right now.

EDIT: I was curious because maybe the Twitter is hopping onto the weird situation as part of the ARG thing. But maybe that voicemail is some weird unexplained signal from a plane. Who knows!!

I’m in the same boat as you. I lost the connection between hijj/cicada and the voicemail. Or rather, I never made the connection between the two. I’m still curious about the guy, his account, and the original voicemail posts!

I am totally agree with connection between voicemail, the flight, the guy's experince and the twitter account. Still following the update though.

Exactly what I’m wondering!

This is all being hijacked to make it look like a hoax now

I feel like thats true. It seems like we were close to finding out something so they had to redirect it. Who was the man outside Ty's house? Where is Ty now? Why would they use an ACTUAL tragedy for an Arg? Things aint adding up...

Yeah, not a bit. I know extremely little about LARPs, ARGs and all that sort of thing, but I'm under the impression that they're usually very vague, cerebral, linguistic/puzzle related things, and they're usually pretty upfront about what they are.

This situation is very different. I wish I knew where Ty went. I hope he's ok...I hope he's alive honestly. Because like you said, ARGs and stuff don't seem to use real tragedies for their games. Not only is this seemingly related to a real tragedy, but it's also linked to a very real and very strange situation that's NOT related to any kind of game.

What if that voicemail had nothing to do with flight 370??? What if it was a true, honest-to-goodness warning being sent out from somewhere? What was it telling us? Who (or what) is behind it? The answer, in my opinion, is certainly not "just more larpers"

This is definitely what I'm thinking. The hjj/cicada thing doesn't seem directly related to the voicemail

It's been hijacked for some ARG or promotion you mean.

You bring up a really good point. Maybe those extra puzzles/clues/trolls were just trying to distract people from the main thing?

I don’t see how all of this stuff ties together. The only solid thing we had was the voicemail- and then suddenly it seemed twitter accounts took advantage of the situation.

Even the ties to flight 370 are so vague. It’s just because one person said that a solar flare made the black box recording show up on some random dudes phone.

I would love if someone could disprove me as it is more interesting if the voicemail is connected to the flight & tweets, but I think everything went waaaay off tangent

I think MH370 is a very small part of this.

So what I can gather is that we have one person who's claimed to find MH370 on Google Maps with bullet holes in it.

Then multiple people have claimed to receive an SOS message through their VM that claims something about "none humans," assumption suggests aliens.

Now posting this all on twitter is where it all goes tits up, because I think there's also an element of trolling and shit, apparently 4chan's involved? So there you go, that's probably lead to people being doxed, hence a lot of weird Latin texts and stuff.

But I don't think that's where the theory ends.

/u/eikogray1111's post goes in to some stuff, like how Elon Musk apparently spoke about the failed SpaceX launch and how they apparently found the wreckage riddled with holes (See, MH370 apparently being found with holes).

As well he touches on the slightly weird urgency from NASA about the upcoming SpaceX launch on the 16th April, and how it's imperative for it to go ahead, apparently because Astronauts need to go that day and no earlier (Why would they launch earlier than scheduled, and why would this even need mentioning?)

And to top it off, this all kicked off on Monday/Tuesday, right when Trump supposed America might create a space army for fighting in Space.

To me it's all a lot of coincidence, probably some trolling and stuff. But the idea that we may, in the next couple of months have irrefutable proof of Aliens is pretty fucking cool.

Though the concept of a space war with Aliens is fucking horrifying.

Yes everything after the Twitter/4chan involvement seems like larp/arg. But I can’t help but feel attracted to the original mystery for the same reason you stated: potentially alien life is involved.

While it is a tragedy flight MH370 disappeared, the amount of time and resources they have put into finding it points to the fact that higher powers are interested in it.

Totally random thought, but I wonder if the recent buzz around Antarctica a few months ago led up to any of this.

I missed the recent buzz about Antarctica, what was it about?

Search Antarctica in only r/conspiracy, the first 4 Threads are very interesting.

r/conspiracy

World Wide Web has 90-99% more information on every topic. Use www.

Yea, I see how the things I mentioned could seem far reaching. I could be completely wrong. I have just been digging through articles and the way I described it is how it was written that they expressed urgency on this launch. I thought it was odd that it specifically said the launch could not happen before the 16th, but had to be done as soon as possible on or after that date. None of these things were directly related to the MH370 tweets, I just wanted to see what was going on with current space affairs and that is what I found. I still encourage everyone to look at the CIA gateway document, its about 29 pages long. Whether this specific incident is a hoax or not, the things that I referenced are not.

I for one am going to be super mad if something happens around the 18th of April. I already bought my tickets to opening night of Avengers infinity war and that's the only freaken space war I feel like being involved in.

i think the entire Elon Musk and NASA deal is weird all in itself, but, would these solar flares spark up a charge in the FDR thats been dead for 4 years? The flight data recorder and cockpit recorder can only be powered for up to 30 days was said to have stopped working in April of 2014 while they were still searching for MH370.

Exactly- so that gets rid of all ties to flight 370.

I still want to believe it was a real distress signal that just got sent wherever it could before whoever sent it disappeared/died but I don’t think it has any connection to the flight or any arg on Twitter.

By the way thanks for updating the thread so diligently, I have definitely enjoyed reading it regardless of my belief on what is going on

Also, why would a SOS distress signal be codified, and in Phonetic Code instead of maybe Morse Code? And why would a message from a black box of a crashing plane be spoken by this very Siri-sounding deadpan voice calmly spelling out a code instead of, you know, a screaming pilot who is freaking out because his plane is in serious trouble, or maybe a crew member speaking, like a normal person, about something suspicious in the plane?

..but you're assuming that the alleged distress call was sent from a plane that was about to crash, when it's been heavily implied (imo) that, in fact, there was no crash & something altogether different happened to the flight.

We mussst go backkk

2 days before 420, that blows man.

Its march, not april..

The supposed happen date is April 18th. April 20th is Weed day. This event is a few days before 4/20.

Oh okay, what a coincidence you made that comment 2 days before 20 march

So you can get high AF with Pleadians!!! What better way to celebrate 420 this year?

Hey maaan, do you have any snacks?

We have some garble flarble left

Its okay, I have water.

Pleadian pizza is the shit. Wait and see...Italians...pffffff ...plus they have unfluoridated water...oh and, you will not be able to pass fluoride past the chemical security squadron (css) upon entrance.

We taught Italians everything they know

When i first saw this thing today, thats the first thing i though lol. Glad to see someone else has their priorities in line :)

The voicemail said “nine”, which is not correct in aviation/military terms as it is too close to the phonetic “five”.

nine = Niner

Say “nine” and then say “niner” And you’ll see what I mean. Nine and five can sound too alike.

larp, arg - who knows. interesting as fuck either way. saving some screen shots.

I think it’s an ARG for sure. I’ve participated in them in the past and it definitely has the correct feel and pacing for it to be an ARG.

can't be cicada. their grammar is bad, no PGP signature, and they're behaving very unprofessionally on their twitter right now.

So it seems like this is just an elaborate ARG? I'm too dumb for those so I'm just going to file this under hoax

This is the most thorough post I've seen on this board in a long fucking time. I tip my fadora to you. Mods should sticky this.

I had no idea about how intricate this subject was before reading your post and I thank you for bringing this to my attention.

Does anyone else think its interesting that all the "leads" in this investigation seem to be easily found somewhere online? Surely if this was something not meant for the public everything would not be found with a simple google search.

I JUST started following this story, I haven't caught up on everything but I wanted to share a screenshot--within the past 15ish minutes, that account that keeps disappearing and reappearing on Twitter posted this: https://imgur.com/a/7KgCD

It is 3.30 in my state, if it makes any difference

Interesting stuff for sure!!

it's probably already been said but the name of the account "dimasryp rea emoh" is an anagram for "pyramids are home"

lunar is home would make sense - it is a secretly held belief that the moon was in all reality the previous incarnate of our Earth many eras ago- intelligent life supporting and the home of our ancestors. https://m.youtube.com/watch?t=5743s&v=GbWMw249xY8

Nice! I'm anxious to see how this develops, I'll definitely be keeping up with everything

Also, for what it's worth, the whole "lunar rabbits" thing reminded me of a VERY interesting story from a friend, kinda gives me shivers if I really think about it

Long story short, we live near a pretty well known military base (not area 51) and my friend's ex-girlfriend had family that worked there. One day she was with her dad on base for something--there was some legitimate reason she was allowed on base with him, I think it was something to do with school or maybe a doctors appointment? Or maybe he had to stop by the base for something briefly, and brought her in with him--I can't remember for sure.

Anyways, they were on an elevator, getting ready to leave the base. Apparently that elevator stopped to let someone in from a floor that normally the girl (or any other civilian) would not have been allowed to see. Just a totally classified area of the base I guess. And when the doors opened to let that other person inside, she saw, bizarre as it sounds, a giant rabbit. Not like 20 feet tall or anything, but like...believably giant. She told my friend it looked like one of those fuzzy Angola rabbits, and it was maybe the size of a Great Dane, or slightly smaller. It had a couple military officials handling it.

She literally only saw it for a moment or two as the door opened, the person walk in, and the door closed--but there was no mistaking it. Honestly, that's so fucking strange that I truly do believe it happened. Why make up something that oddly specific?

Anyways, just wanted to share, because I'm still catching up with all of the hijj370 tweets, but I've seen a couple about those lunar rabbits, and I couldn't help but make a connection. Maybe it means something???

Hopefully the feds don't show up at my door for this (LOL), but we are in very close proximity to Wright Patterson AFB, in Dayton Ohio. I personally live about 10, 15 minutes or so down the highway from it.

My own family has had experiences with them too--in the late 1960s (66 or 67 I believe) my grandma, who lived on a big ranch-type property in our town at the time, had a UFO experience. One day pulling into her driveway, her car started acting strange, and she saw lights flashing in her back yard, which was an apple orchard. She ran to the back and saw the classic saucer-styled object, with rings of multicolored lights flashing around it. She watched it for a couple moments, and then it zig-zagged away, literally burning off the tops of all her trees.

She was in the Dayton Daily News for it (I have the article buried in my basement somewhere) and within a week she had Project Blue Book guys and other military officials knocking on her door, telling her to shut up about it. They told her that if anyone else from the media wanted an interview, she was to tell them she didn't want to talk about it.

Did the feds show up?

Look up North Korean giant rabbits. They did manage to breed them and sold them to the previous Kim. Not sure if it's related.

It’s weird that this was the first location that came to mind for me.

I want to see that rabbit! Sounds amazing...and fluffy.

Hoax is sent until its a fact....could this be to the affect of a cover up of the plane until its uncovered?

Good idea.

The account name looks like scrambled letters spelling PYRAMIDS ARE HOME.

So, this is a Reality game afterall and help upcoming Cicada events? based on this twitter account

The Cicada3311 Twitter posted this 14 minutes ago https://twitter.com/Cicada3311/status/975117183843004416?s=20

ARG confirmed

What did it say?

It's Cicada 3301, not 3311. That account was made this month.

Edit: Also account deleted / renamed / whatever.

Cicada 3301 was the last round of this puzzle. They are using 3311 now to differentiate.

I just can’t really get behind this being a real Cicada puzzle. All of the previous puzzles have been hard to solve, and with no official word on it either.

I believe the accounts that messaged the OP and now the Cicada acc were trolls messing with OP and taking advantage of the voicemail’s contents.

As for the voicemail I have no idea if it’s real or not. The only person who knows that is Ty himself.

No that’s exactly why I don’t believe this is really a Cicada puzzle, I’m almost 99% sure this is just some bored kids who wanted to hop onto the bandwagon with the voicemail itself.

The only real creepy thing here is the voicemail which seems real but there were a lot of inconsistencies between it and a real SOS message according to a veteran family member of mine.

This ty guy doesn't seem like he wanted the attention or would go to such great lengths and fake the whole thing but who really knows

We'll never know the truth about the MIB/First voicemail, I say we separate all info from the 'fake' twitter accounts and what Ty has posted.

Ah, harder, but it will help narrow down the confusion. Really this guy who claimed to be Cicada, distracted us from the original source, Ty's predicament. Before he deleted his account, looking through his stuff, his account was honest to god something you would skim over, maybe follow for a few funny memes he posted. Obviously there is a point of a drop off from the source material, separating were reality becomes 'fake' could be useful and help figure out what happened to Ty.

Ah gotcha, welp I guess it's a waiting game then?

So this is just an arg cicada puzzle?

Ok, also i feel like i missed how the original tweet is related to the cicada account, did i miss something or is there no hard link between them

Ok makes sense thanks

Bioinformatician here. I looked a little more into the DNA sequences.

First all, its from a mouse specific microarray, which off the bat seems a little sketchy (in the sense that it is not sketchy at all). Basically, it's a little chip that contains a bunch of mouse specific DNA sequences that you can use to tell how much of a certain strand of DNA you have. No way this would be used for an unidentified creature.

However, you can look up the DNA sequences using a technique called BLAST, which lets you search for documented other sequences to see what your sequence is for.

I used BLAST (on the first sequence): ATCATCGTAGCTGGTCAGTGTATCCTTTTTTTTTATCATCGTAGCTGGTCAGTGTATCC.

Nothing came up, which means that it hasn't been documented in mice. That's actually a little strange.

The other thing that bothered me about this is that the technology is extremely old. Microarrays aren't commonly used to do this sort of stuff (identify unknown transcripts).

I'm not sure what to think, it is interesting it hasn't been documented before, but I think all of the other circumstances make me disinterested in pursuing this more.

Wdym its not mice and it could be sea creatures? I am very, very lost

/ATCATCGTAGCTGGTCAGTGTATCCTTTTTTTTTATCATCGTAGCTGGTCAGTGTATCC. I knew my biology would someday make me understand

Can someone please give me a really short version re: what the topic here is so I get what this is about?

For some reason the initial audio won't play for me. I tried yesterday several times.

edit: thank you

Doesn’t make much sense. Hard to see the connections

A girl gets a military coded voicemail that translates to HELP SOS DANGER THEY AREN'T HUMAN and gives coordinates. The coordinates are close to where the Malaysia missing plane was last seen. People are pouring in with evidence suggesting that the call was linked to it's disappearance and are providing theories and evidence as to why it went missing.

Strangely this exact story was in the front page yesterday with a similar title.

https://www.reddit.com/r/conspiracy/comments/84x0n4/not_political_twitter_user_receives_creepy

Don't know if anyone did this already or if it matters, but on the reversed video that was reversed again by the redditor that doesn't want to get too involved that OP mentions, the NATO alphabet that's spouted out fast comes out to "lunar is home with space triangles are built with haste."

The directly correlates with the moon bitby country bluff it says Home at the end dang thats weird

I belong to a facebook group called "Creepy ones" and someone posted this https://www.facebook.com/photo.php?fbid=10155670869668051&set=gm.1200507850086668&type=3&theater

(im not sure if you can see it since its a private group. Anways. the post basically said his girlfriend got a weird text message that read "WARNING non threatening terrestrial threat signed at 18 ° 51S 41 ° 56'W" It seemed like it could potentially be related to this? so i thought id post it.

Please share a Screenshot

I don’t think this is anything tbh. It’s a town on a river. In Brazil. Can update with image link soon

Edit: hopefully this link works https://imgur.com/a/r0w2a

I searched for something extraordinary that could have happened in Governador Valadares, but I came with nothing, only a plane forced to land on Doce river em 2011 (everyone survived)

Found this, though

https://www.youtube.com/watch?v=LkzUkI_gcC4

This video was used in another moment before. It was been proved that isn't a brazillian video. Link (in portuguese) about this situation http://aconteceunovale.com.br/portal/?p=100881 (anyway, I wish to know what this light in sky was)

The Mariana disaster the happened in Brazil affected the rio doce, the coordinates is too near rio doce, something relative perhaps ?

The morse codes with photocopied notes have some brazil notes too, but not related.

WTF Governador valadares is a place in Minas Gerais - Brazil with no relevance.

The only SMALL significance I could guess is the link to the Air France Flight 447 incident. (Scheduled to fly from Brazil to Paris, France). But that’s grasping VERY FAR for straws here. This is literally nothing. There is no relevance.

But in the AFR447 acident we in Brazil stand for the theory of the ice in tube of pitot. Airbus is a fully automated system and the wrong information could lead a to acident.

I agree. That’s why I say the relevance is too far to link together.

actually that region is fully related to ufos.

Governador Valadares, Varginha, Serra

Those places in brazil had been HUGE cases of UFO.

its been a long time since i was in brazil but i can confirm that

I know about Varginha but it's 629 km of distance of Gov. Valadares.

"Non threatening terrestrial threat" 🤔

I absolutely do not believe Cicada are behind this. The account posting their information is so...informal..bad spelling and grammar etc

yeah, not professional at all, nothing like how cicada usually is.

literal insanity im reading here

http://imgur.com/X52Czm0

We talked about this already, further down in the comments. The location from the coordinates is unrelated

Edit, here’s the link to the parent (works hopefully) But anyway, thanks for posting the screenshot cause now we can look into the number it came from!!

https://www.reddit.com/r/conspiracy/comments/853vyr/comment/dvv5o6a?st=JEW33WCI&sh=1691ab5e

Edit again: saw you were the original poster. We’re still looking into it

https://www.channelnewsasia.com/news/asiapacific/malaysia-airlines-final-report-on-missing-mh370-10025954

So, aliens decided to contact this dude coincidentally just a week after this. Talk about convinient aliens

The original post was from the 13th. Hawkins died on the 14th.

Please provide proof that it was posted on the 13th

http://i.imgur.com/EUj2ONQ.jpg

Hawking died in the UK very early in the morning on the 14th, which would be the 13th for the US and before this tweet was made

The post was posted at 12:59pm

I would also like to point out that the VM he is listening to said "Friday" which was not the 13th.

Edit. Okay I thought it said Friday but the post I was following was removed again. Can't provide proof. D:

This is the alien warning

https://www.reddit.com/user/skimmer47/comments/8523q4/you_need_to_act_quickly/

No one is going to post or know where they worked. The message looks coded though, seems to have some tripwires. There is some other stuff there that doesn't make sense.

Their post/comment history is empty for me.

Ok It discussed the fact that ships are apparently coming to earth in like a few weeks and that we need to prepare. Also why would an account be suspended for investigation?

Can you repost what was deleted?

The deleted account cicada370 posted this before it was deleted. The hidden youtube link directs you to a creepy video. Upon further research, I looked at more of the guys videos and found this video where the description mentions "(SOS) April view the moon". ALSO - the title refers to someone called Jack. Another tweet by cicada370 also referred to someone called jack here

The video about "jack" which refers to April - just like those (possibly fake) twitter accounts - was created just 8 days after the Malaysian Government supposedly payed the US government a sum of money to find the missing plane, of which the deadline is April 18th :/

do you have any links regarding the deal between Malaysia and the US?

I saw a news article - a few actually - but I'm sure if you google them you'll find some. I think one was actually deleted.

The random numbers in the title, moon coordinates maybe? Or Coordinates for depicting a point in the sky and not on a globe?

shit, that's a good idea. any way to check that theory?

Lots of references to the moon. Project BlueBeam perhaps?

Project BlueBeam? I haven't heard of them. Any info on them that you think would be useful?

It’s kinda tricky to explain but basically America fakes an alien invasion by using holograms in the sky. It also relates to the Moon being a hologram, as well as the Sun being a local body and acts as more of a spotlight then a large ball of gas (yknow flat earth, all that malarkey)

Cicada370/Hijj370 posted this on their account. Lunar = moon. I think that's more than a coincedince.

They’re username is “home aer pyrsamid” I found something about the home aer part but not a lot about the “pyrsamid”

Tweet goes: ABCDEF G HI 370 jack5

HI 370 jack5

370 possibly referring to MH370

HI jack5 ...hijack?

Shit, that makes a lot of sense

Probably unrelated, but found another twitter user with more zalgo text talking about the moon rather incoherently. https://twitter.com/Adducere_Pasco

No rabbits on this one, but does talk about sheep. More than likely not related, but I thought I might as well pitch this one into the mix. You never know!

someone received a voicemail around 10 hours ago. this voicemail is in english though so i believe it is fake. https://twitter.com/basspeare/status/974877855636164608 has NATO code at the end of voicemail

edit: another guy has been trying to track hijj370 and has found multiple accounts relating to hijj370. the latest account is following the guy tracking him and has a tweet in morse code that translates to indonesian which translates to stop in english. https://imgur.com/a/3XgLQ i believe this is fake too

Another girl posted a message not from an unknown number.

https://mobile.twitter.com/itssamigirl/status/974385913621983233

Coords in Africa is the last theory I read last night.

The ones in the call from the "Ky" girl lead to the Gulf of Guinea, close to Nigeria. If they are coordinates, they are incomplete though. Still getting the "not human" from the phonetic alphabet.

I got nothing from the ones in the other call. Probably "fake" since it shows a number and not unknown as the other calls

Reading through this makes my head spin. This may sound sadistic but I actually hope it all means something and isn't just some marketing campaign, or prank by someone.

Yeah. You don't often see calls from "Unknown", at least in my experience. Makes it seem real.

I can't help but jump to wild conclusions in my head. Perhaps MH370 was taken by aliens but someone has figured out how to communicate back to us.

I get quite a number of “unknown caller” calls

I've never seen it. Its usually just a really long, random number I don't recognise.

You can prevent that number from showing up with almost every cellphone, caller ID then shows up as unknown caller in the receivers phone.

I thought if you block a number, they couldn't call you?

Not that kind of blocking. Sorry english isnt my native. You can prevent the number from showing. Thats what I meant. I'll edit my comment.

military posts often contact you from an unknown number, for example my prenatal dr on post always calls me back from an "unknown"

here is a twitter account we found last night that replied to the original tweet. It seemed to be nothing, but we were able to decode the audio file on the video on the account which gave us this image which contains the text "mischief re" which we think means mischief reef. This island is actually called Woody Island, but there are theories that it could be connected to Diego Garcia. There is still undeciphered code on the account.

It does resemble woody island off of Google image.

We've deciphered what we believe is the username, but we don't know exactly what it means. Is the text replying to the voicemail still unciphered?

Yeah we can't figure that out. What do you think the username means?

Here's what we know so far:

1. Bio reveals settings for an enigma machine
2. If you take the numbers out from the username, you get coordinates around Indonesia

d6a7c7617be97c79d7d430463fa6af8f gives us:

6.77617977, 97.43046368

Assuming you are supposed to separate the numbers from the letters, then the letters give us:

dacbecddfaaff

We don't know what to do w/that info. Maybe an onion link?

Aperture Science is from the game Portal isn't it? Portal 3 release 4/18?

https://m.imgur.com/KuFNLxl

The text below "Good luck"

This comes after Valve announced they are shipping games again. For what its worth, Portal 2 was released April 19th of 2011. The more I see this the more it sounds like we have an ARG on our hands here for Portal.

April 18th is the day the Portal 2 ARG countdown finished. http://valvearg.com/wiki/Investigation_History#April_18

So you're saying... HL3 reConformed?

I edited my reply a couple times. The portal 2 ARG sounds pretty similar in a sense to whats going on here. http://valvearg.com/wiki/Investigation_History Heres the whole page

Does look similar. Thx

Previously canceled Half-Life 2: episode 3 was about missing ship going through multiple realities/dimensions. Also this is supersimiliar to Valves previous ARG. Portal 2 was also released 14.8.

http://valvearg.com/wiki/Investigation_History http://valvearg.com/wiki/Investigation_History#April_18

If this is an ARG for Portal 3 I'll fucking dance naked at work.

Let the man dream.

„He has changed his name to Hijj370 once again and has this in his profile. First thing he tweets after coming back is this. His bio has a braille code

.--../._----...----

When decoded it results with:

add onion“

I guess with add onion he means we should add .onion to something to land on a Tor hidden site (.onion) sites.

Who wants to volunteer to do that? Lmao

Yeah, it could be that he meaned that, but wasnt that already .onion and didnt had to be addee? Maybe there is a second .onion, maybe not. Could be.

Maybe the unreadable qr code could have something to do with it? Maybe we arent meant to decipher it the regular way (qr reader)

[deleted]

This userlink ain’t working? Everything you click on just gets more shady and frustrating Edit: nevermind , I got it

This is driving me crazy, I need some answers. It's just very weird. It seems likely that whoever is behind this hijj account is a master troll. The water heater video took a dark turn.

I’d bet my left but this is deathgrips hyping their new album.

Right before it went down again he said is was for cicada, some quiz.....

So it’s offical this is for the cicade puzzles

Account changed to @Cicada3311. Check his pinned tweet. It’s a game.

thanks bud, this is getting interesting

Not officially - no PGP signature. This could still all be a hoax.

Cicada3311 seems like bullshit.

Maybe it's me wanting to believe but this can't be a real Cicada puzzle. I saw previous puzzles and they were nothing like this they wouldn't start from a normal civillian and Cicada himself would definitely not make an official statement. They opened their PUBLIC DMs right now what the hell?

But if that account is fake then that means that all these leads are fake right? most of these leads were gathered from that account... I really want to believe man I want to see those ships...

i mean, people that work on Cicada puzzles are "normal civilians" - maybe she's part of orchestrating it but also has a normal twitter because she's just a person. (unless you mean, like, ostensibly a normal person - i interpreted it as "why would they send a random person a voicemail to start the puzzle")

The account Cicada3311 has been deleted/changed 05.12 AM Indonesian Time.

Waiting for new update.

I thought it was Cicada 3301, not Cicada 3311?

Well shit, this will tide me over until the next Petscop episode I suppose.

🌽🌽🌽

Hey guys just a reminder, remember when qanon said follow the white rabbit? Idk just something to think about i guess.

There's a podcast about a creepy arg called Rabbits

Rabbitspodcast.com

Teach me to reddit in my sleep senpai

This whole thing reminded me of this podcast, if u have Google play you can just search rabbits under podcasts, maybe a regular Google search will turn it up

What a WILD story. I’m inclined to think more than one hoax/bamboozle is going on here. Waiting to see where the Cicada angle leads.

Thanks for the hard work OP. Can people back this post so it doesnt magically get deleted.

Was just thinking about the strange rabbit references, and remembered there is a podcast about a mysterious game called rabbits. Maybe this is somehow connected. This is from the description on the website.

"Rabbits is much more than just a game, and that the key to understanding Rabbits, might be the key to the survival of our species, and the Universe, as we know it."

https://www.rabbitspodcast.com/

rabbit, or habit?

EMH?

Is any of this being transmitted over radio? You know governments still communicate to spies to this day through encrypted messaging. Maybe someone picked something up and ran with it, but I doubt Twitter and YouTube would be platforms to choose to communicate.

In a world that lives with their faces in their phones....why wouldn't it be? They would be the best platforms to reach humanity on.

Agreed. Especially if this is alien life forcing disclosure upon us since our leaders are going slowly about it. I would absolutely figure out how to use a species’ most common method of information sharing to announce my arrival to all of them instead of revealing ships in the sky (shock value) or revealing myself to a select few (take me to your leader).

Who's trying to reach humanity? Aliens?

I made a discord:

https://discord.gg/qrNBqN6

This is awesome, great post.

Nice, comprehensive, thorough, plentiful. Hope this blows up for ya!

What's new with This? We're close

strayedaway/ty deleted his account

edit: or maybe he changed his name

Uploaded this collection of screenshots.

https://imgur.com/gallery/NxBZx

He has since started posting again, will update with more screenshots and try to order them chronologically. Edit: Changed the link to an updated and chronological version

his collection got deleted

updated it!

https://imgur.com/gallery/NxBZx

I also see it as deleted. But by whom?

I'm pretty sure by him because if anybody else who wasn't him deleted the account it would say this account has been restricted or something but because it just doesn't exist now, that means he did.

What's up with the rabbits?

Italian coordinates mentioned. http://www.italianways.com/the-pink-rabbit-in-colletto-fava/

https://www.youtube.com/watch?v=e_1haffjVWI&feature=youtu.be

What the fuck go watch the “water heater” video on their playlist. There is a dead body.

WORD this shit freaked me out

That's the rabbit from the chrildrens book, goodnight moon too

Knew I recognized it good catch. Thought it was from peter rabbit or something.

Just realising that before Cicada370 deleted their account again, they posted something that said "We are LunarRabits"

well, look at this.

see a connection?

https://www.google.co.nz/amp/s/www.bbc.com/news/amp/world-asia-china-36972205

China's Jade Rabbit has bid its final farewell and shut down after 31 months exploring the Moon, far outliving its expected lifespan.

Watch the water heater video on their playlist. There is a dead body, also the video titled chair has a person strapped to the chair at the 2 seconds remaining point.

water heater video with dead body

Wtf

That's a body that was recovered from the lost Franklin Expedition in the Northwest Passage.

person in chair at 16 second mark

[deleted]

Non-Mobile link: https://en.wikipedia.org/wiki/Malaysia_Airlines_Flight_17

^{HelperBot v1.1 /r/HelperBot_ I am a bot. Please message /u/swim1929 with any feedback and/or hate. Counter: 160834}

why was his post deleted what the fuck

something about triangles are easy? simple? something like that.

If you watch secureteam10 and all the UFO footage he posts - most of it is described by 3 lights in usually a fixed triangle formation. I think most of the UFOs captured on video in the night sky are almost always in some kind of triangle formation.

I admittedly skimmed the top post so I may have missed this, but has this video been mentioned in here yet?

https://youtu.be/bs-h-n8Tmcg

I came across it on one of the Twitter threads last night. Comments should explain...

This freaked me right the fuck out

I have been following him up date and his account is gone. Probably due to high traffic, it could be due to that person who took pictures of his house and the threats of him not taking down the call from his phone. I took a video of that call he had so now it's on my phone. I have it saved on my phone and on a different phone.

Everything concerning this subject is completely void on Facebook. Every time I posted something about it since last night, it got taken down.

That was my first thought. He posted telling people to unfollow him and get off the theory kick so that's highly likely.

Just saw that the Malaysian aircraft was found???? Is this real?

Im a bit confused on how the videos with the water heater and dead body connect to this.

Do you think it is connected to this in some way? Any theroies on what the Rabbit deal is? I hope this isnt connected to Valve or Portal, unless its something deadly.

Someone needs to fly a drone or two down that hole.

The more I look into this the more it feels like an ARG. Also have something that could prove it’s an ARG, I saw a twitter reply stating the original account that sent the “delete the message post” was already created a while earlier: I think by a couple of weeks

What is an arg?

An "Alternate Reality Game" ?

Thanks

Anyone brought up twitter user @DRT8190729 ?

Let me know if anything comes of it

01:57 AM Indonesia Time.

The Account has back. Some images, QR Codes, videos has been updated.

In this Video someone made reverse the video. I do my best to translate them. And the translate is "lunar is home with space triangles are built with hast"

EDIT : This post made me thinks if he/she doing all of this was prank and troll.

Some QR Codes leads to photo of the Part of the Moon and some other lead me to another QR Codes.

EDIT 2 : He made this tweet

Yes it is, The video is reversed. I saw someone in the reply section made a version of re-reversed.

I'm convinced it's just a piece of the 2018 puzzle.

Reports coming out that some guy has apparently found the plane... way too much of a coincidence with this twitter thing all happening

Source?

Gotta link bud?

https://www.mirror.co.uk/news/world-news/missing-flight-mh370-found-google-12205561

cMahon told Daily Star Online : “Four Americans were sent to Australia to oversee the findings of MH370.

“They have made sure that all information received has been hidden from the public, even our government – but why?”

McMahon says authorities “do not want it found as it’s full of bullet holes, finding it will only open another inquiry”.

Ghyslain Wattrelos lost his wife and two children in the tragedy. He believes the plane was shot down.

He thinks Vietnam, Malaysia and Thailand could be withholding vital information.

Ghyslain said: “All the military from these countries have seen the plane, if we believe that version. Why are they silent?

“I do not know, but there are also other countries that have information like England with Inmarsat, with Rolls-Royce, like the United States with Boeing and like the FBI who went the next day and took the pilot's flight simulator and never said anything to the investigators.

“Why this silence? There is something we do not want to say in this story.”

Thanks

Yikes, that site was rough on mobile. I wonder if that’ll pick up traction/if anyone will actually search that location.

Has anyone emailed the hotmail account?

Did you try both with the NATO words all spelled out and with just regular letters?

Yeah that’s what I meant - I was making sure you sent it to that email as well as spelling all the words out just to cover all your bases!

I did. No reply yet

I'm spooked

New tweet "Hijj Ends Cicada Continued"

So that account is Cicada.. but it’s almost like Cicada saw this getting big and used it as an opportunity to promote their new mystery or whatever.

I don’t know how many different things we’re really dealing with here it’s all over the place.

Put no pgp signed message ... not sure if it's 'offically' cicadia but sticking around

I’m about to reply to one of their tweets asking if we can get some sort of PGP signed message.

https://www.reddit.com/user/skimmer47/comments/8523q4/you_need_to_act_quickly/

What do you guys think of this? It was created right around the messges coming online

I was reading on it earlier and went out to try to snag the address. I can not get back to it. Says it has been deleted.

Cicada is back, it seems

Apperently they opened dm's for questions ..

Same .. wouldn't mind a puzzle solving arg but don't pretend to be cicada

From their twitter:

'We haven't said yet that this isn't connected to MH370'

'×This Event is no where related to catastrophic events × 18 april is definitely safe ×All other accounts are impersonating ×reason to hold this event is to help people solving a upcoming global cicada event ×reason to hold this event is to aware people with knowledge'

Yet the shit they've been posting has been linked to MH370 (dates) and they've been linking things about 18th April, fuck this

The tweet got deleted, it was a reply to someone else saying 'We haven't said yet that this isn't connected to MH370'

Maybe April is the day TeamFourStar will release the Dragonball Z Abridged season finale for the Cell Saga.. makes sense since he's a cicada and everyone dies..

Stay woke everyone

Do we have a Discord for this yet?

If a discord gets started lmk

I absolutely am, ha. It’s quite a bit of fun to keep up with, though. Would be fun to have a Discord to keep updated in real time.

@cicada3311 is Gone Again

I DMed them asking to post something online with a PGP they didn’t respond lol

So what explains the rest of this?

Account down ???? Wtf

CICADA370 > Hijj370 > CICADA331 accounts/tweets = confirmed fake now?

Ok so if that hjij account whatever is fake then all that shit they posted means nothing right? However, what about the original voice mail and the guy taking photos?

Yeah and all the other weird accounts and videos

http://lunarrabbit.com

Maybe it is an elaborate advertisement or whatever for this game company? Their website is also copyrighted from 2016, when the lunar rabbit 4/18/18 video was uploaded.

Follow the white Rabit Through the looking glass Their Gateway

Look to the documents released last year from the CIA.

https://www.cia.gov/library/readingroom/docs/CIA-RDP96-00788R001700210016-5.pdf

What are these? Are they real??

That is the CIA’s website, no?

Is this some sort of remote viewing session or something?

This one in particular is an internal research paper. The casualness of the verbiage reeks of normalcy — being something that they have come to accept as a matter of fact in this particular document.

https://www.cia.gov/library/readingroom/docs/CIA-RDP96-00788R001900760001-9.pdf

/u/arszilla in ref: “We are them”

Indeed it does. You need to dig deeper.

Where does it mention the Rabbits?

Whoaa excuse me? Sounds almost like a dmt trip.

No, it is a government document of a remote viewing session which was facilitated by an official.

I didn't mean that it actually was one, just stating the similarities in his responses to his surroundings.

Update: Cicada3311 got deleted.

So I did some research on the County Bluff youtube account, and I will tell you that the filming location is in Utah, the counties listed in the Weather cast video state Morgan Valley, Weber County, and Ogden. I also reversed and sped up the audio for the Chair video and it states "Don't Forget" very clearly.

There’s definitely some interesting audio stuff hidden in those vids - I’m interested to see what that voice is saying in the boiler one too

Alright I will start working on that. Apparently my posts are getting removed because I am new, so I will reply here.

Wheeler mortuary is in Springville Utah. Big rock candy mountain is as well.

omg.. IT´S THE BEAST FROM THE EAST CATHY

NIN did something on a much smaller scale for Year Zero.

Nine Inch Nails...Year Zero album. It was not a traditional album. I don't recall all the details but I know some people found thumb drives in bathrooms at concerts that had vague info on the album

https://en.wikipedia.org/wiki/Year_Zero_(album)

He was envisioning what a post bush era would look like in 2020. The event was also spotted with mock kidnappings and swat invasions of the concerts.

The album would have worked just as well with Obama however he'll need an entire new album for the post Trump era. lol

https://www.youtube.com/watch?v=G2xXu8_2Exo

Seems legit

After further digging, I can confirm It was indeed posted before his death

Bricks will be shat. Bug-out bags are packed.

Before whos death? Sorry i skim read the post.

from what I can see it was the same day, he woke up to the texts, this page shared it yesterday, so that would place the texts late Thursday night/early Friday morning.

I had the screenshots from a huge post on facebook and sent them to brother. They are now deleted?!? Weird. How can they confirm it was before his death? I dont see any links?

I made have missed it, but where is the direct mention of flight 370 from the original account? I may have missed it but was under the impression that the connection was being inferred and not a direct mention

How can we be certain that Hijj370, Cicada370, and Cicada3311 are all one and the same?

It just seems like completely different writing styles and tone between Hijj and 3311. They also feel contradictory to one another.

It just doesn’t seem cicada at all — but I feel like that would be the nail in the coffin for this. At least, if it was me in the position of damage control of this unintentional leak, I would let it continue under the guise of an ARG... problem solved.

theres has been reports of lights over governador valadares right now. parents that live in brazil confirmed

That's where the text from that Facebook group mentioned.......

trying to find something using the geo tag on instagram, but just people happy drinking etc living their lifes on saturday night.

but something weird is going

Definitely something fishy... people drinking on a weekend? Wtf???

What did your parents say exactly? Don't get my hopes up lol.

Ok fucked up, translated the hex from the video on Steven M YouTube account and there is hex correspondence related to the weather@outlook.com email, and then changed email to orbiting@rediffmail.com , all in phonetic alphabet. Will upload links in a bit

https://imgur.com/gallery/zKlFb

vro the @cicada3311 acc was following my twitter, https://twitter.com/andrew_v69, i'm the only one they were following within the past 24 hours. also they sent me a DM saying "welcome to 3311" on god

Cool, now post a picture of it

correction: were following. they unfollowed me a few hours after they sent me this DM. sorry for not responding/clarifying, i don't use reddit. proof: https://gyazo.com/e901b56e4efc38d58f3bee2de05ec8a8

you can't send me a DM unless you're following me.

Hi, I'm a bot that links Gyazo images directly to save bandwidth.

Direct link: https://i.gyazo.com/e901b56e4efc38d58f3bee2de05ec8a8.png

Imgur mirror: https://i.imgur.com/Zs95osv.png

^{Sourcev2 | Why? | Creator | leavemealone}

Either government application code. Spy signals. Or crazy larp

It has been going on for a wile on twitter, giving us hexadecimals, ascii85, qr codes, and so on. Riddling us regarding MH370, aliens, UFO`s and so much more.. Has been fun up until the accounts where gone..

Does anybody know if @strayedaway/Ty is okay? He hasn't posted anything in 12 hours. Hopefully, he's okay and he's just hiding.

I just saw he deactivated. I’ll text him.

someone on tumblr has screenshots, but i lost the post. ill go look for it. and he tells me hes ok, just needs space and to not believe any accounts with names similar to his

He just tweeted this

Its, gone, you remember what it was?

It just said good morning to the girls who stole a bus from vine or something like that.

His account is no longer loading any tweets

Huh. I wonder if he deleted it because he didn't want to deal anymore or maybe because someone made him do it.

Yeah, theres a lot of shit getting deleted now. Most links posted here ended up being 404’d or deleted tweets. Im still unsure if I want to believe this, but at the same time I want this to be real....okay maybe if theyre deadly aliens then nope.

There's a good Reply All podcast about what this might be, they play spooky but compelling bits of audio that makes a listener stay on the phone longer for some 800 number scheme.

Podcast link below:

https://www.gimletmedia.com/reply-all/104-case-phantom-caller

[removed]

Are you ready to share friend?

Please update.

update: https://twitter.com/hijj370 is back up

[deleted]

[deleted]

account is gone again, but two new videos

first reversed video: https://twitter.com/EggerdingEmily/status/975040969270874112 second one was nato code i can't seem to find it

[deleted]

got all the vids up on my imgur link https://imgur.com/gallery/NxBZx

Yeah, it's top to bottom newest to oldest. I couldn't get a lot of the originals though because I started after his first deletion.

And gone again

cicada370/hijj370 posted this which, when reversed, says this. July 17th, 2014 is the date that the flight MH17 went missing.

I personally think that the cicada account and the voicemails are entirely unrelated - perhaps people saw an opportunity to create an ARG from the conspiracy theory of the voicemails. I wouldn't panic too much.

it was definitely July 17/18th - it's on the BBC news website and several others.

EDIT: I'm dumb. The flight 17 went down on July 17th. Not the flight 370. I READ IT WRONG

Anyone got a link to the original voicemail? Looks like he deleted the tweet. Curious to hear it myself.

Cicada370 posted something (that I was too late to view) before deleting his account again

i ran the qr codes Hijj370 posted through a qr reader. bigger qr this one gave me a series of numbers or letters that i ran through google and it led me to chapter twelve of War of the Worlds. ch 12

small qr this qr code led me to this site last words shits spooky my guys

Fixed your link? Click here to recheck and delete this comment!

Hi, I'm a bot that links Gyazo images directly to save bandwidth.

Direct link: https://i.gyazo.com/a16c3781861b2b82960b49ecff3c3e84.jpg

Imgur mirror: https://i.imgur.com/FrzUCxQ.jpg

Direct link: https://i.gyazo.com/ecf51d156c41d768735f5acefff91e37.jpg

Imgur mirror: https://i.imgur.com/iBGeiDT.jpg

^{Sourcev2 | Why? | Creator | leavemealone}

I listened to the final hours of Japan Air 123, the whole thing. The last words the pilot said was "This is it. I'm sorry. Goodbye" while the alarm kept saying "Terrain. Pull up. Terrain Pull up." You could also hear the pitch of the air thinning between the plane and the ground. So chilling that I'm shivering right now. And to think that their government knew were it crashed and didn't think to look for survivors because they were convinced that no one survived. When they did make a recovery search, the medical team discovered that a good number of them lived for at least an hour or three afterwords but died from exposure. So sad.

Hey, I found that account : https://twitter.com/Bdbxtjmsa1

Grant us eyes...

ahhh...mother Kos... or as some say... Kosm..

Gritter 3.0

Sorry, meant "The Grifter 3.0"

The scariest, most inhumane video ever

send? cicada370 said 3.0 starts now. later he said 5.0 starts now.

I don't have it anymore, (didny want to get vanned) if you search the hole long enough, you might find it.

What was in the vid out of curiosity?

I haven't heard of this. Care to summarize for us?

I don't know if it's worth adding, but I saw the posts about this yesterday and thought nothing off it.

Now my friends on Facebook are sharing posts about the "SOS it is dire that you evacuate" posts on Twitter.

So that means it's getting very popular. It's starting to feel like some kind if psy ops craziness.

I said "it feels like some sort of psy ops" not that it was. It just sorta seems, uh too convenient to be getting popular. This kinda thing just doesn't get popular on Facebook.

Yet it's got publicity for some reason amongst the mindless meme sharing that is the book.

i really hope this gets figured out, I've been obsessing over it all morning and afternoon. If it is fake how did this person get the original poster on Twitter's number?

I've been checking out the youtube videos from County bluff There's the video 4/18/18 showing the moon, a rabbit in a chair, and the words THINK HOME. Then checking the Song for jack video in the description in NATO it says SOS APRIL VIEW THE MOON. If anything is set to happen with all this we'll have to wait till that night and see. I'll definitely be spending all night outside staring in the sky. If anyone has a good telescope set it up to the moon and maybe set up a live stream for people to see. I really hope this isn't an ARG or something a long those lines.

County bluff seems to be uploading rather frequently now

@half_baked2010

Has anyone looked into the numbers in countrybluffs description? the moon video title has them and the description of weather cast and antlers,

Ty mods for mega thread.

Colvetta Fava had this weird thing.

Non-Mobile link: https://en.wikipedia.org/wiki/Colletto_Fava

^{HelperBot v1.1 /r/HelperBot_ I am a bot. Please message /u/swim1929 with any feedback and/or hate. Counter: 160873}

[deleted]

http://www.mobi-antenna.com/uploadfiles/2017/09/201709131821392139.pdf

What's interesting is that a search of this video brought me here.

https://www.youtube.com/watch?v=e_1haffjVWI

4/18/18 556e68756d616e20657272

on duckduckgo.

I’m just here for the spooks, but, Cicada is a strange username to show up on a puzzle like this. Cicada3301 was (maybe still is) a HUGE riddle similar to this but on a different platform. I don’t know if it was ever solved, for I dropped out of the race to figure it out to solve personal issues. Best of luck y’all, just thought I’d throw that in.

there hasn't been a new cicada 3301 puzzle in a while, maybe its related? whatever it is it's creepy as fuck

Definitely

Only reason I don’t think it’s for something like Portal or Cloverfield is because neither of them would make reference to a real life plane disappearance where people lost members of their family - seems disrespectful and I don’t see them doing that.

Fair but if they handed the PR of the ARG over to a firm or even they may have felt it was enough to grab attention

Is there a subreddit for all these findings?

You're in it.

weather@hotmail.com Just curious if anyone has tried to email this yet?

You seem to know too much about things. You will have to explain what and how you know. whiskyechoalphatangohotelechoromeo@hotmail.com

It came from one of the QR codes.

If this is all one hoax why was there MIB outside the guy's house taking pictures?

He lied?

It was part of the making of/elaborate setup. It's not far fetched to have this planned in advance.

Go look into LHO or Laughing Horses Orafice.... It's an art group that really is just a director and his friends. They made a lot of fucked up art and made a bunch more fucked up websites all registered to "Bob".... These websites are kind of meant to make you think there is a conspiracy of some sort. Really Graceful and BadGuacamole got caught up in the LHO stuff when pizzagate broke last year.. because several people on 4 Chan were posting the LHO links as WikiLeaks evidence. (yes, they were trolling )... Grace later figured out that the director of the movies is highly regarded in the Chicago , DC, and Houston art scenes and these websites were only made to troll.... Then grace and guac found sexually suggestive (of minors) art that the director had shot and been praised for (legal but very gross). Was it LHO a conspiracy?... No... Was it entirely separated from pizzagate? Yes and no. Here's one of the movies made by Laughing Horses Orafice https://youtu.be/dROz_uKxgTE

What's my point here? Is this QR thing an art project? I don't necessarily believe it is at this moment, but there are groups out there that would rather have people waste the than look for truth. This all looks more menacing than LHO, so I'm looking elsewhere for explaination. I really thought this vid I posted was fucked up. Guac gave it to me last year as I was supposed to run his subreddit (but he disappeared). Thanks for considering.

HEY His name on Twitter is a sort of anagram for “pyramids are home.” My account is too new, I can’t post. Please add to Op that there’s a genius kid in Russia who swears the pyramids have alien life inside and we just discovered there’s a void inside the Sphinx and he says that he’s an alien!!! https://youtu.be/oKDFdSmLb0k https://i.imgur.com/6h3WEbc.jpg

The guys twitter is gone .....

I'm really curious as to whether this is a real phenomenon, or simply just a LARP/ARG/hoax.

That water heater video ruined it completely. The “dead body” is a mummy named John Torrington

tmi

Wow thanks for all that work, interesting whatever it is

Pretty interesting stuff. But from what I know from prior elaborate sequences of encoded messages, this is almost certainly a hoax of some sort

What prior sequences?

Just any number of similar instances to this. It just seems like whenever there’s something that’s far too elaborate, with a number of over-the-top weird images or videos, it’s always some sort of contrived bullshit (but still attention-grabbing nonetheless). Just looking at the situation here, we have a bunch of encoded messages in a bunch of different types of code. Why bother using a bunch of different types of encoding to get the message across?

https://mashable.com/2009/07/15/internet-hoaxes/#K1u8.fo2USqP

Seems like an alright arg. I've had worse.

Hello! I come from YouTube with a pretty decent investigation into this case (I hope at least). Sorry if it looks like advertising but it's a small contribution from my part.

Here's the link: https://www.youtube.com/watch?v=M3j78ryw9Yw

Super interesting. Keep me posted.

Update hijj just made another post saying hijj ended cicada continued

/u/Arszilla will you add the reddit post that I linked?

If you don’t want to it’s fine

Oh sorry I thought you saw it I posted it in the comments earlier

Here it is https://www.reddit.com/user/skimmer47/comments/8523q4/you_need_to_act_quickly/

Cicada Reborn

Whoever wrote the Latin doesn't know the language

No I mean, the person who sent the text doesn't know latin. It should be "omnes nostri morientur" all of us will die. It should also be "malum depellendum est" which would be "there is a need to drive out the bad thing".

Could be many things trying to sway the main subject off course now.

Can confirm the Stephen hawking Morse code, I translated it and replied back to the tweet, it's on my account ajws7036

It was posted after his death

I think the account trying to say that he doesn't related to Official Cicada as he say. "×It will be continued in 16 hours

×Everything that's unrelated to the quizzes will be posted in English

You will need to back up previous tweets for future quizzes

×reason to hold this event is to help people solving a upcoming global cicada event

×reason to hold this event is to aware people with knowledge"

I my opinion, they trying to say that they want us to helping each other when Cicada happend, as he stated that "reason to held this event help people to upcoming Cicada event"

The only thing i don't understand from voice mail, missing Malaysian plane (MH370) suddenly related To Cicada.

cmiiw. i am a bit new into conspiracy-thingy.

ah, i see

I see. I want to see the updates of this lol

I would like to point out that unmistakable similarities between modern warfare and bf4 have already been connected with past events irl. woody island happens to be the largest island of the parcel islands, where bf4 has a map taking place on a large island with a crashed plane (bearing red stripe) surrounded by many smaller islands, taking place in the south China sea.

Forgive my ignorance - what does PGP mean?

Ah thank you! And thanks for all your work on this thread.

This is the only thing keeping me from actually WORKING on my midterms lol. This is my only excuse

Basic gestalt?

Has anyone looked into the symbols from the original tweet? Have it saved in my images not sure how to attach.

The picture of the dead body at 61 seconds here: https://m.youtube.com/watch?v=KvfbhxeeKfY

I swear I have seen this picture on a website before but I can’t remember where..

Frozen body from an 1800's arctic expedition.

https://owlcation.com/humanities/johntorrington

Bingo. Thanks.

can you do a google pic search?

next Cloverfield movie confirmed

^/s

Twitters back folksss

Rockstar?

Could this be why Kim Jung Un is relinquishing power to the U.S? The aliens are coming and all he has are some fireworks to throw at them? This could also explain the jump defense spending.

Can we get a TLDR

Someone in marketing is getting a raise

Pardon me if I missed this in the post above but I was looking at the country bluff youtube account and came across this other account under Steven M. m it’s really weird. And in the comment section there’s a bunch of comments with just numbers. Probably just nothing but wanted to share

Wow wtf ... Link to this?

Translating some of the comments and it’s really creepy. It seems so unusual. One of the YouTube accounts names spells out moon. And they’re talking in hex about information and being under military surveillance and stuff.

Yes want me to comment here? Or message? The link is the same to that video just in the comments

https://m.youtube.com/watch?v=nFgH1srXtt0 Transcripts of the hexidecimal conversation on the comments of this video I came across this video after seeing the country bluffs videos. Note that the videos description was changed to June 12th 2011 and that all these comments came in the last 24 hours. The description in the video is decoded above.

Mike Oscar Oscar November “You seem to know too much about things. You will have to explain what and how you know. whiskyechoalphatangohotelechoromeo@hotmail.com”

Merlin Clark “The information is safe how can i be sure what you are saying is true. i request furthur information on the topic and i shall not share what i am told.”

Merlin Clark “Gnosis”

Red “You are under military and xAoxIwRob survaillanceerNot Human we Not human You will not go unharmed”

Merlin Clark “Prove it. Email me like we have been to this point.”

Merlin Clark “Are your comments important or just the other videos?”

Red “You are not quite aware with whom you are dealing with. I may be a valid source of information. See you soon. due to inconveniences from oppositioning party i have chosen to change our means of contact. oscarromeobravoindiatangoindianovembergolf@rediffmail.com”

Merlin clark “then why reply in hexadecimal then? and change your description as well?”

Red “so irrelevants can’t read our messages? Do not sway from the topic at hand. The account is hijacked and I will not do harm to the channel.”

Merlin Clark “If this is related to Cicada then make it known, You have no evidence to support any claims you are making. and the email you provided me with didnt exist, give me a method in which to contact you.”

Red “As aforementioned, I do have the evidence necessary. This could potentially help both of us. Essentially, I have figured out the last piece of the puzzle. I just cannot trust you with the information I possess as your account is obviously an alias of someone else’s. And again, the email is orbitingyou@rediffmail.com.

See you soon”

Steven M “It seems I do. But can you not say the same?”

Merlin Clark “What will happen to the moon April 2018?”

Mike Oscar Oscar November “We demand you to share any of your knowledge. What we do know dosen't matter. You know where to answer and you are pleased to use that email adress in order to keep those informations safe. We are not ennemies but we have to be sure any of those data is safe”

I’ll do what I can I’m translating the whole convo in the comments and I’ll retag it with a link to the video and how it was translated with the hex to text

Yeah I didn't see the link in the comment they posted lmao dont mind me

Nvm lmao got it

Sorry I put an m for the link like an idiot lol

From the comments, is where we got the initial email from moon, I translated some and got another email, in phonetic alphabet - spells out ORBITING@rediffmail.com . "Due to some inconvinece from oppositioning party I have chosen to change our means of contact"

another fun LARP.

I can look back through everything as much as it'll let me, let me check again. Kinda sucks everything's been deleted. I was almost positive it was before hawking died

There was this big post going around with screenshots of everything on Facebook but I can't find it, I'm hoping I can it documented quite alot

Yea I think it got deleted. Not on my friends wall anymore

I didn't save anything and it kinda pisses me off, I did all the translation while I was at work

If it wasn't before, it was on

That's a shame, if it was before we could have found something huge

Did some Google searching since their image caches haven't caught up with the page being deleted... It says the pic was posted "1 day ago" and that could mean 1 day or 1day and a few hours ago... Up to two days, in my experience. It's now the 17th, he was on FaceTime at 07:08 am, the DM was sent at 05:58 am. I just don't know what the caption for the posted pic was.. as in if it was a certain day

Also you call check my [facebook](Facebook.com/ajws7036) , I just reposted it... I looked at one of the pictures. I couldn't tell whether the datestamp said 3/16 or 3/13 because only the tops of the numbers are showing and three and six look similar on the top

just realized i've been commenting wrong, i am new to reddit

http://imgur.com/KxJVTC7

It seems like the original poster of the video (@strayedaway) made another twitter account with the original video as the only post (@strayedaway_)

Not sure if it's real, most likely a fake, someone please verify, thanks

He said every other account is a fake he is going private, from my understanding

The new account was made a little over an hour ago, so while it could be fake, wasn't there someone who knows them irl in the thread somewhere? Hopefully they can verify it. I'm assuming it's also a fake, but we never know lol

here are some leaked files from the missing flight:

https://www.reddit.com/r/MH370/comments/5u6qr9/rmp_report_links/?st=JEW8QW5C&sh=bc0b8086

I thought they may be of use

While not required, you are requested to use the NP (No Participation) domain of reddit when crossposting. This helps to protect both your account, and the accounts of other users, from administrative shadowbans. The NP domain can be accessed by replacing the "www" in your reddit link with "np".

I am a bot, and this action was performed automatically. Please contact the moderators of this subreddit if you have any questions or concerns.

space pyramids

This is stupid, but could be an ARG for Destiny 2, as the ending cutscene featured space triangles and stuff

Destiny puts damn near no effort into their game as it is. I doubt they would invest the time on something like this. I miss Destiny 1 :(

I know right, a man can dream :(

Can someone try to do some research on that channel pop blast that was trying to expose Shane Dawson for nothing? I was going pee and I had an idea that the channel and the cicada puzzles from a while back are connected in someway

Why don't you?

Because I don’t have a reliable computer to do any background research into it, I get that I’m using a smart phone but anything that gets into code cracking fucks up and leaves me with a incomprehensible answer

My brother said this was confirmed by one of the people involved to be an ARG. Not sure if that's true or not.

People involved?

"people"

"Non humans?"

aliens

Tell your brother lesson one in critical thinking is to trace and cite proper sources 👌🏻

The OP literally says Cicada3311 said this was an ARG. We have as much reason to believe Cicada on that as we do to believe them on anything else.

But also mentioned no PGP verification was provided.

Right, which is why I said we have much reason to believe Cicada on that as we do to believe them on anything else.

Ehh, it was in passing. So I don't blame him for not bringing a spreadsheet up and detailing where he got it from.

The account @cicada3311 that posted it being an ARG seems to be unlrelated to the voicemail that @strayedaway posted. Just someone trying to get all the traffic on there twitter

At first when reading this I thought it was already April, and I was like 'holy shit, tomorrow is the 18th...I'm gonna go meditate', but then I realized it is March. Still got some time to Netflix n chill.

Take this with a grain of salt, but, good to have a date for the Earth bifurcation and dimensional shift. I've been preparing for being on either side of it, but in my heart I know I never belonged here.

I love all of you, even the mean ones. They are funny.

This explains the feelings resulting from the solar flares. I think they are like patches or updates to consciousness to prepare people. If you didn't feel anything, don't worry, seems most just felt emotionally up n down over the last few days, not thinking it was anything special.

Damn you tryna match coz u smoking on GAS lmao

Fuck dude this has me dying lolol

i dunno what that means, but I like it, no troll

I remember people saying the same thing in 2012/2013, almost word for word. Why would this be any different ?

I dunno if I have any logical response, only my subjective experience and intuition, which can and have been wrong in the past. That said, they've also been right.

There does seem to be a lot of momentum building up on a lot of fronts towards a crescendo of sorts.

Personally, Ive been on a mission to wake as many people up as I can over the past few months, not really knowing why Im on the mission. Ive been rewarded with positive energy and increased intuition power. Sometimes people respond with vitrol and rage, but thats OK.

This feels good and right so Im gonna keep doing it no matter what friends and relatives say.

I recently read Dolores Cannon's The Three waves of Volunteers. It gave me a purpose I didnt even know was there. The book sheds a lot of light on the topic.

dunno what thats all worth.

link to the book The Three Waves of Volunteers and the New Earth

https://dolorescannon.com/waves-volunteers-earth-generations-souls/

This book explains pretty much every aspect of the messages.

Look into dan winters. He talks a lot about how time is not what we think it is and that it actually moves backward so as we approach this catalyst whatever it is, people are starting to wake up and remember it happening before it does. He is a genius and I am not. My explanation sucks but search him out if you don't already know of him.

holy shit. google is fucked up right now. i did a google search for dan winters and it came up with nothing. then i switched over to bing and there was a bunch of stuff on dan winters

this censorship is like being in china all over again

This building to a crescendo is something I've felt a lot since the new year started. I've had the constant feeling that something really good is coming, after years of shit (personally and it seems globally). I'm by no means psychic or anything, but occasionally I'll have repeat feelings/dreams that come true. I had dreams of my pet rabbit dying last year for 3 months before she died, and she wasn't sick or anything. I had the same feeling for three months after getting a new car that my tires would blow. 2 blew within a couple weeks of each other. It's just odd small things like that usually.

Interesting, I had an emotionally awful day and I don't know why. Straight rage. I started coming down sunset. Was there a post about it?

yeah, my day got a lot better around 5pm, not too far off sunset. I was expecting this kind of thing from my experience since last flare, but today was pretty crazy. I even meditated twice and took a 3 hour nap. still had crazy feelings.

I posted something in the conspiracy sub before the flare happened. not sure its on the same wavelength as this sub though.

https://www.reddit.com/r/conspiracy/comments/849daf/solar_flare_tomorrow_ride_the_energy_if_you_know/?utm_source=reddit-android

Thanks. Nah, r/conspiracy is one of my favorites. By far, the most entertaining and enthralling subs on Reddit. When there's a good post anyway. Yeah, today was intense and I'm always pretty chill. Thanks for the link

oh, thought your comment was in /r/psychic for some reason. There is a similar post going on there too.

While not required, you are requested to use the NP (No Participation) domain of reddit when crossposting. This helps to protect both your account, and the accounts of other users, from administrative shadowbans. The NP domain can be accessed by replacing the "www" in your reddit link with "np".

I am a bot, and this action was performed automatically. Please contact the moderators of this subreddit if you have any questions or concerns.

Hey! So this is an ARG? one of those investigation games, I mean. I'm not very familiar with those.

Ya I was wondering that to I dont know if that account is that posted all that nonsense about it being an ARG is even related to the original 370 voicemail or just someone using the voicemail trying to get attention to their twitter ? Idunno

Ty just tweeted again. Says he simply deactivated his account so he wasn’t harassed.

[removed]

This post is now my all-time favorite on reddit. Thanks OP!!!

Hijj/cicada3311 is by no means affiliated with the real cicada. Cicada has never acted like this before, writes much more coherently and intelligently, and would never use basic ass codes. Not sure what the voicemail is really about, but the rest of the stuff has killed it for me. The other stuff is so obviously bullshit that it takes away from the actual, initial event, and hurts the legitimacy of real conspiracies.

I honestly feel that that the plane and cicada are entirely unrelated. That is my intuition. On the other hand, something about that 4/18/18

I think Hijj was trying to warn people and Cicada telling that its a game is a coverup for the warnings.

So whats the go here? Is this real or an ARG?

The original message seems real, digging around i found that a few unrelated other people had apparently received the same voiced message.

This twitter account stuff seems fake though. The messages have been getting less believable with each one, and looks like whoever was behind the twitter accounts seems to have run out of ideas, since we're now down to simple number -> letter conversions. Not to mention they opened up their DMs at one point to answer questions privately, that was a dead giveaway for me.

I just posted this in another thread but I'm relatively certain that the coordinates line up with the area the Singapore national service goes to train, like there are army camps there.

Wtf, Google cicada 3301. This is a group who puts puzzles and alternate universe scinareos. Bro, this is a game, to recruit codebreakers and linguistics, just do some research about their previous contests.

Do we have any idea of what is supposedly going to take place on April 18?

If you Google anything concerning April 18th 2018 conspiracy, nothing of relevance is returned. I mean nothing. 3 video links from YouTube pop up on the mobile version of chrome and none of them concern anything. Everything that was a search result was plant conspiracy or other items unrelated. Really makes me wonder what is being censored. I for one hate that I'm told what I can and can't find out from the internet

There is also a man that is a preacher claiming that April 18 will be the rapture due to what xstain mythology says.

http://kbwealth4u.com/rapture.htm

So I am new to this, but I first saw this on Facebook. Somebody compiled some of the stuff already and as I started to read it, my app crashed. So immediately thought let’s see if it’s on the conspiracy sub. I then found the mega, and halfway reading, my app crashed again. This is rather strange. It’s too well thought out imo.

Considering no one else is having that issue, it's safe to say it's your phone.

My app crashed too wtf

i had this issue AND it logged me out of my account. five times.

If something happens on April 18th, I love you all and I'm glad I got to Reddit with every single one of you.

At this point in my life, I kinda just want something to happen. Whether it affects me negatively or not. I just want validation that something else is out there.

Me too mate

Love you

Same. I've spent so much of my life wanting to believe in ETs and UFOs, that even I started to think I was crazy. But if there really is something out there... I don't know. I really don't know.

I think to believe that we are the only species to inhabit a planet is extremely close minded. I don't have anything against people who believe that but even if nothing ever show itself and we never know, I believe its more probable than improbable.

Love you

Love you

I think.. I can actually agree and disagree without any remorse? We've been teased and had conspiracies and things hidden or faked to us.. I want to know whether we're headed into the apocalypse or the super high tech future.. I think we all want validation if there is something out there.. but for now we wait..

Love you

Love you

The meteor hits tilted towers on April 18th.

Just a reminder...one more day!

You can come out of the bomb shelter, we're all safe now.

https://docs.google.com/presentation/d/1l8zrTP2FyNOfr5Yc_NpErSwipDBDnu1vaexVdiYwyiA/edit?usp=drivesdk

I’m dumb can you explain this too me?

Yeah sorry did this super late at night. Here is the website where i got this from. https://steemit.com/cicada3301/@defango/3-14-day-update-1711141131131-xyz-or-cicada-3301-2018-live-solving The link i originally provided is a series of slides showing his progress thus far.

Seems like an ARG or some type of Viral Marketing scheme. But for what maybe it's a social experiment? I've recalled hearing this on a semi national talkshow. Possibly it's a mass marketing scheme for a new game? I've found out there was clever marketers that did similar strange videos and tweets but it was for a new movie or TV show. I forget what the movie or TV show was about I believe it was for a new movie. The. Video started off like a typical clogger showing how to do something I believe applying make-up or doing a review. And something strange happened and let's just not get into graphic details. Obviously was a strange advertising. Because YouTube would've removed such a video. But it was talked about on various vlog compilations. Maybe this is a marketing ploy or an ARG?

The original voicemail and info was interesting, but once that cicada twitter account got involved and started tweeting cheesy 10th grade codes it became as obvious larp.

IDK now people are getting Amber Alert messages with weird codes

Can you provide a link?

Has anyone called and left a message at the phone number in the County Bluff Fishbowl video?

https://youtu.be/wVI6hlwzWIg

No, I mean call the phone # 406-298-5948.

Now there's a message... Sierra Oscar Sierra The Coordinates are posted.

I see others have tracked it down to a Kentucky Fried Chicken in Salt Lake City.

Yeah, in the Fishbowl video. It's a Montana phone #. But the sign is for Harman's restaurant, a KFC in SLC, UT. The phone # has that recording, call it!

I called that phone number 13 minutes after that video was posted in the early morning. It went to a voicemail box with the same voice from the Twitter Voicemail. I freaked out and hung up. 6 minutes later it called me back and I didn't answer, hoping for a voicemail. It didn't leave one, meaning there was probably a person on the other end.

When I called it, I blocked my number.... haha! Guess I was paranoid too. I can see how it was scary to get a call back from the number in the middle of the night.

Looking more at the County Bluff videos, I think this person is in Utah. Bluff, Utah.

I wish so bad this was real tbh

3 15 19 13 9 3 12 9 2 5 18 1 20 9 15 14 19 15 15 14

Cosmic liberation soon.

1 12 12 23 9 12 12 2 5 20 1 21 7 8 20 20 8 5 23 1 25 15 6 20 8 5 16 12 5 1 4 9 5 19

This is getting creepy. I was thinking maybe there was a connection to the Pleiades meteor shower earlier today. Coincidence maybe?

Well seriously, this screams Portal 3 or (possibly) Half-Life 3 related to me. Aperture Science? I have no idea what is going on, but some of this surely smells like a Valve ARG.

Maybe all the co-ordinates are related to the Borealis ship in Half-Life 2: Episode Two?

Who knows, but some of it is pretty interesting anyway.

This whole story is getting quite strange. I know ARGs tend to be all vague and creepy but some of the recaps included in this mega-thread like the County Buff videos and the bunch of Cicada tweets are giving off a explicit horror vibe, or a vibe I don't feel Valve has ever implemented in their marketing campaigns. Also the theme seems to be all over the place and sometimes too unprofessional.

This could however be a case of some randoms trying to cash in on the event, producing their own 'clues' that end up deviating us from the main ARG.

But I must admit that that website indeed screams Portal/Half Life. And interestingly enough it was just a couple of weeks ago that Gaben commented that they would start shipping games again, whatever that means.

I can't get that website to pull up either.

16 12 5 1 4 9 1 14 19 1 18 5 8 5 18 5

4 15 14 15 20 20 18 21 19 20 1 19 8 20 1 18 19 8 5 18 1 14

THE NEW DEATHH GRIPS ALBUM IS GONNA BE FUCKING AWESOME. STAY NOIDED

BUBBLEGUM BURIED IN THE JUNGLE

Some guy / guys have decoded this quite a lot: https://steemit.com/cicada3301/@j1337/pi-day-cicada-3301-1711141131131-xyz-update-early-3-14-decoding

Really really interesting stuff.